ORFeome > c1ql4 ORF1 – XORFeome v1.0

c1ql4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c1ql4
Gene ID: 5831114
Gene Page ID: 5831112
ORF Xenbase ID: 17267049

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123271
Original XGC clone length: 735

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ838785
dbEST ID: 79656487
Trimmed Sequence: ATGGTACTGATCCTGCTTGTTGCCATCCCTTTGCTGGTTAGTAGCTCTAAGAGTAGCACCCACTATGAGATGTTGGGCAGCTGCAAGATGGTGTGTGACCCTTACACTCCTCAGACACATGGGGCAGATTCCAGCCAAGAATTAGCTCTAATTTCACCACCACCCAACCTTCAGGTAGGTAAGGATGACCAAGGCAAGAAAGGCAAATCAGGAATCAGGGGACTTCCAGGGCCACAAGGACCACCAGGACCTAGAGGACCACCTGGAGAACCGGGCAGACCTGGACCCCCAGGCCCACCAGGTCCTGGGCCAGGAGGATATGTCTCTTCCTATTACAGCCCCAAGATTGCCTTCTATGCTGGGCTAAGGAAGCCACATGAGGGCTATGAGGTGTTGCGATTCGATGATGTTGTGACCAATGTTGGAAACTATTATGAGCCATCAACTGGCAAATTCACCTGCCCCTTGCCTGGGATCTACTTCTTTGCCTACCATGTGCTCATGAGAGGAGGGGATGGGACCACCATGTGGGCAGAATCTCATGAAAAACTCCACAGGTACGTGGCAGTACTATTGCTCAGAATGCAGAAGAGAACTACGAATATTCCCTCAACAATGTGATTCCTGGCTTCTAAAGTTCCGGGAAGAAGTTTAGCGTTAAGGTTGAAAGGGGGGGTGGAATTTGGGGGTAGCGACTGCTAGTAAAAAGAAGCTGCGTTTTCGCTGGTCTTTTTTCGGCTGAGTGCCGAAAGGGCCGCGACTTTTGGTGGGGGGGAGATTGGGGCGGTGTGAGGAGGGGGGGAGGTGTGCCTTATGACGTGTTTTTTGTGTGGGC
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTACTGATCCTGCTTGTTGCCATCCCTTTGCTGGTTAGTAGCTCTAAGAGTAGCACCCACTATGAGATGTTGGGCAGCTGCAAGATGGTGTGTGACCCTTACACTCCTCAGACACATGGGGCAGATTCCAGCCAAGAATTAGCTCTAATTTCACCACCACCCAACCTTCAGGTAGGTAAGGATGACCAAGGCAAGAAAGGCAAATCAGGAATCAGGGGACTTCCAGGGCCACAAGGACCACCAGGACCTAGAGGACCACCTGGAGAACCGGGCAGACCTGGACCCCCAGGCCCACCAGGTCCTGGGCCAGGAGGATATGTCTCTTCCTATTACAGCCCCAAGATTGCCTTCTATGCTGGGCTAAGGAAGCCACATGAGGGCTATGAGGTGTTGCGATTCGATGATGTTGTGACCAATGTTGGAAACTATTATGAGCCATCAACTGGCAAATTCACCTGCCCCTTGCCTGGGATCTACTTCTTTGCCTACCATGTGCTCATGAGAGGAGGGGATGGGACCACCATGTGGGCAGAATCTCATGAAAAACTCCACAGGTACGTGGCAGTACTATTGCTCAGAATGCAGAAGAGAACTACGAATATTCCCTCAACAATGTGATTCCTGGCTTCTAAAGTTCCGGGAAGAAGTTTAGCGTTAAGGTTGAAAGGGGGGGTGGAATTTGGGGGTAGCGACTGCTAGTAAAAAGAAGCTGCGTTTTCGCTGGTCTTTTTTCGGCTGAGTGCCGAAAGGGCCGCGACTTTTGGTGGGGGGGAGATTGGGGCGGTGTGAGGAGGGGGGGAGGTGTGCCTTATGACGTGTTTTTTGTGTGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTACTGATCCTGCTTGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838784
dbEST ID: 79656486
Trimmed Sequence: GTCTGGGTAGATGATAAAACCAGAGAAAGTGCTGTATTTGTTAGTGTTGCCACCATGAACTTTGCCCCCATCCAGTTTAACGTAAACCTCATCCCCGACATCTAGATGCAGGATGACACTGTTGCTGGCATAGTCGTAGTTCTGATCTGCATCTTGAGCAATAGCACTGGCACGTACCTGTGAGTTTTTCATGAGATCTGCCCACATGCTGGTCCCATCCCCTCCTCTCATGAGCACATGGTAGGCAAAGAAGTAGATCCCAGGCAAGGGGCAGGTGAATTTGCCAGTTGATGGCTCATAATAGTTTCCAACATTGGTCACAACATCATCGAATCGCAACACCTCATAGCCCTCATGTGGCTTCCTTAGCCCAGCATAGAAGGCAATCTTGGGGCTGTAATAGGAAGAGACATATCCTCCTGGCCCAGGACCTGGTGGGCCTGGGGGTCCAGGTCTGCCCGGTTCTCCCGGTGGTCCTCTAGGTCCTGGTGGTCCTTGTGGCCCTGGAAATCCCCTGATTCCTGATTTGCCTTTCTTGCCTTGGTCATCCTTACCTACCTGAAGGTTGGTTGGGGGTGAATTTAGACCTAAATCTTGTCGGGATCTGGCGGGTGTGTCGGAGGAGTGGAAGGGGGACGGCGCCCGCTTCCACCTCCCCCAACTTCCCTTCTTGTTTGCTACTCCTGAGAACCTCTAACCAGCCAAAGGAAAGGGCGGCAGAAAGGGAGGGAGTACAGGGGGGGGGGAACTTTTTTTTGTAGAAGAGTTTGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGGGTAGATGATAAAACCAGAGAAAGTGCTGTATTTGTTAGTGTTGCCACCATGAACTTTGCCCCCATCCAGTTTAACGTAAACCTCATCCCCGACATCTAGATGCAGGATGACACTGTTGCTGGCATAGTCGTAGTTCTGATCTGCATCTTGAGCAATAGCACTGGCACGTACCTGTGAGTTTTTCATGAGATCTGCCCACATGCTGGTCCCATCCCCTCCTCTCATGAGCACATGGTAGGCAAAGAAGTAGATCCCAGGCAAGGGGCAGGTGAATTTGCCAGTTGATGGCTCATAATAGTTTCCAACATTGGTCACAACATCATCGAATCGCAACACCTCATAGCCCTCATGTGGCTTCCTTAGCCCAGCATAGAAGGCAATCTTGGGGCTGTAATAGGAAGAGACATATCCTCCTGGCCCAGGACCTGGTGGGCCTGGGGGTCCAGGTCTGCCCGGTTCTCCCGGTGGTCCTCTAGGTCCTGGTGGTCCTTGTGGCCCTGGAAATCCCCTGATTCCTGATTTGCCTTTCTTGCCTTGGTCATCCTTACCTACCTGAAGGTTGGTTGGGGGTGAATTTAGACCTAAATCTTGTCGGGATCTGGCGGGTGTGTCGGAGGAGTGGAAGGGGGACGGCGCCCGCTTCCACCTCCCCCAACTTCCCTTCTTGTTTGCTACTCCTGAGAACCTCTAACCAGCCAAAGGAAAGGGCGGCAGAAAGGGAGGGAGTACAGGGGGGGGGGAACTTTTTTTTGTAGAAGAGTTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGGGTAGATGATAAAACC