ORFeome > c22orf39 ORF1 – XORFeome v1.0

c22orf39 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c22orf39
Gene ID: 6255523
Gene Page ID: 6032456
ORF Xenbase ID: 17267091

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130096
Original XGC clone length: 321

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ837616
dbEST ID: 79655318
Trimmed Sequence: ATGGCTGACTCGGGTTGCTGGAGGCCACCACGCGACTGTGACGATTACTGGTCTGAATGGAAACACTGCAAGAGTCTGAGAAACCGCTTTCATAATTATTACACCTATGGAAAAGCACCCGAGTGTCAAGAGTGGAAAAGAGACTACATGACCTGCAGAGACTGGGAGAAAACAAAGAGCAATAATCTCAAGGAAGCTTTGCAACAGAGTGAAAAGACAAGGCTCGAAGGCAAGCAGAATAACTCTCCTGTATGGACATTGAGAAAAAATCCCCCACCAGACTGGTACCTACCGCTAGACCCTGGAAAACCTAGACAATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGACTCGGGTTGCTGGAGGCCACCACGCGACTGTGACGATTACTGGTCTGAATGGAAACACTGCAAGAGTCTGAGAAACCGCTTTCATAATTATTACACCTATGGAAAAGCACCCGAGTGTCAAGAGTGGAAAAGAGACTACATGACCTGCAGAGACTGGGAGAAAACAAAGAGCAATAATCTCAAGGAAGCTTTGCAACAGAGTGAAAAGACAAGGCTCGAAGGCAAGCAGAATAACTCTCCTGTATGGACATTGAGAAAAAATCCCCCACCAGACTGGTACCTACCGCTAGACCCTGGAAAACCTAGACAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAATGTCAAAAAATAAAAAAATATTATATTGCTCCTCTTTGGGAAGGGGGGGGGGGAAAAAAAAAAAAAAAAGGTACCCAGAAAGGGGGGGGGCGGCTTCTTTTGTTTTTTTGGGGGGAGGGGAAGCCCCCCACAAACACCCCCCTCCCCGGGTGGCTGGCGGGGAGGGAAAAAAAAGAGGGGCCACCGACGGGGGGGCCCCCCCACCTTTTGGGGAGAAAAAGGGGGGGGGGTGTGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGACTCGGGTTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837615
dbEST ID: 79655317
Trimmed Sequence: TTGTCTAGGTTTTCCAGGGTCTAGCGGTAGGTACCAGTCTGGTGGGGGATTTTTTCTCAATGTCCATACAGGAGAGTTATTCTGCTTGCCTTCNAGCCTTGTCTTTTCACTCTGTTGCAAAGCTTCCTTGAGATTATTGCTCTTTGTTTTCTCCCACTCTCTGCAGGTCATGTAGTCTCTTTTCCACTCTTGACACTCGGGTGCTTTTCCATAGGTGTAATAATTATGAAAGCGGTTTCTCAGACTCTTGCAGTGTGTCCATTCAGACTACTAATCGTCACAGTCGCGTGGTGGCCTCCACCAACCCGAGTCAACCATGG
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAANAAAGTTGGCAATTGTCTAGGTTTTCCAGGGTCTAGCGGTAGGTACCAGTCTGGTGGGGGATTTTTTCTCAATGTCCATACAGGAGAGTTATTCTGCTTGCCTTCNAGCCTTGTCTTTTCACTCTGTTGCAAAGCTTCCTTGAGATTATTGCTCTTTGTTTTCTCCCACTCTCTGCAGGTCATGTAGTCTCTTTTCCACTCTTGACACTCGGGTGCTTTTCCATAGGTGTAATAATTATGAAAGCGGTTTCTCAGACTCTTGCAGTGTGTCCATTCAGACTACTAATCGTCACAGTCGCGTGGTGGCCTCCACCAACCCGAGTCAACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCGATTTGTTGCAACGAACAGGTCAATATCAGTCAAAATAAAATCATTATTTGGGGCCCGAACTTAAAAAAGAAAAAAAAAAATATAAATCTTAAGCTGTATAGAAGACATGGGGGGAGGGAGGAAAAAAAAAAGCAAAACCCAAAAATCGCGGGGGTGCCCTTTCTCGGTAATTTAGGGAGGGAAACCACCCAGCGAAAAACACCAACCCCCGGGGGGGGGGGGGGGGGGGTGGGCCCCTTCCGCCTTAGAAAGGTGTCCACAAGCCAAGACCAACAACACCCCGGAAGGGGGGGGGGGAGGGGGGGTGGGGGGGGGTGTGTATGATTTTTTTTTTTGGGGTGGGCTCACACGCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTCTAGGTTTTCCAGGGT