ORFeome > c2orf40 ORF1 – XORFeome v1.0

c2orf40 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c2orf40
Gene ID: 997590
Gene Page ID: 997586
ORF Xenbase ID: 17267097

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC044044
Original XGC clone length: 411

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ824396
dbEST ID: 79642098
Trimmed Sequence: ATGGTGGTTCTGCTTTTCCTTCTTGTAATATTGCTATGTCCCGACAGTACAAATGGAAACAAACTTAGGAAGATGCTGCAGAAGAGAGAAGCTGTGGAGCCATCTAAACCCATTGTTTCAGTGAAAGAAAGCAAAGCTAATGAGTTCTTGAATTCTCTAAAGAGGCCAAAACGTCAACTTTGGGATAGGACTCGACCTGAAGTGCAGCAGTGGTACCAACAATTTCTCTACATGGGTTTTGATGAAGCAAAATATGAAGATGATATGTCTTACTGGAAGAATCAGGGACGTGGAGGCAGTGAATACTATGGAGGCTTCCACCAGCATCACTATGATGAAGATGCTGCTATTGGGCCACGCAACCCATATACCTACAGGCATGGAGCTGGAGTCAACTATGATGATTATTT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTTCTGCTTTTCCTTCTTGTAATATTGCTATGTCCCGACAGTACAAATGGAAACAAACTTAGGAAGATGCTGCAGAAGAGAGAAGCTGTGGAGCCATCTAAACCCATTGTTTCAGTGAAAGAAAGCAAAGCTAATGAGTTCTTGAATTCTCTAAAGAGGCCAAAACGTCAACTTTGGGATAGGACTCGACCTGAAGTGCAGCAGTGGTACCAACAATTTCTCTACATGGGTTTTGATGAAGCAAAATATGAAGATGATATGTCTTACTGGAAGAATCAGGGACGTGGAGGCAGTGAATACTATGGAGGCTTCCACCAGCATCACTATGATGAAGATGCTGCTATTGGGCCACGCAACCCATATACCTACAGGCATGGAGCTGGAGTCAACTATGATGATTATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACTGGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAAACAAAAAGAATAGTGTTAAAAAAAAAGGGGACCTCCGGGTTATCTGGCTCATACGTGGGGCTATCGGGGCGGCAAACTTTCATCCCCCGATATGGACAAAAAGGGAAAATTTCAACGGGAGAATTTTTTCTGACAACCAAACCGGGCCCTGGCCAGAGGTAAAACAACAATCCAGTCCCCTGGGGGCGGGGCCATAAAAATCCAGTCTGGTAAATCCCCCAGAAATAGAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTTCTGCTTTTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829753
dbEST ID: 79647455
Trimmed Sequence: ATAATCATCATAGTTGACTCCAGCTCCATGCCTGTAGGTATATGGGTTGCGTGGCCCAATAGCAGCATCTTCATCATAGTGATGCTGGTGGAAGCCTCCATAGTATTCACTGCCTCCACGTCCCTGATTCTTCCAGTAAGACATATCATCTTCATATTTTGCTTCATCAAAACCCATGTAGAGAAATTGTTGGTACCACTGCTGCACTTCAGGTCGAGTCCTATCCCAAAGTTGACGTTTTGGCCTCTTTAGAGAATTCAAGAACTCATTAGCTTTGCTTTCTTTCACTGAAACAATGGGTTTAGATGGCTCCACAGCTTCTCTCTTCTGCAGCATCTTCCTAAGTTTGTTTCCATTAGTACTGTCGGGACATAGCAATATTACAAGAAGGAAAAGCAGAACCACCATGG
Full Trace Sequence: GGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAATCATCATAGTTGACTCCAGCTCCATGCCTGTAGGTATATGGGTTGCGTGGCCCAATAGCAGCATCTTCATCATAGTGATGCTGGTGGAAGCCTCCATAGTATTCACTGCCTCCACGTCCCTGATTCTTCCAGTAAGACATATCATCTTCATATTTTGCTTCATCAAAACCCATGTAGAGAAATTGTTGGTACCACTGCTGCACTTCAGGTCGAGTCCTATCCCAAAGTTGACGTTTTGGCCTCTTTAGAGAATTCAAGAACTCATTAGCTTTGCTTTCTTTCACTGAAACAATGGGTTTAGATGGCTCCACAGCTTCTCTCTTCTGCAGCATCTTCCTAAGTTTGTTTCCATTAGTACTGTCGGGACATAGCAATATTACAAGAAGGAAAAGCAGAACCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCGAGCTAAAGACAGGCCGTCGTTATACACAAACGTGAACCGGGGAATATGCCGGCCCGCCTGGATCATTGTTCACCAGGTATTTCAAATTGAAAGGGGAAGGAAGGGATAGCAGGTGATATCCGTATGGTGCTCCCCCTTACGAAATCCGGATTCACAGAAATCAACTTAAAACGTTTTTCATCCCCTTAGGCAGGAGACACTACCAGAAAATTCCCCAGCCTAGTTCTTATCCCATTTATAATATCAAAAAAGATGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAATCATCATAGTTGACTCCAGC