ORFeome > c3orf38 ORF1 – XORFeome v1.0

c3orf38 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c3orf38
Gene ID: 963608
Gene Page ID: 963602
ORF Xenbase ID: 17267157

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097724
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ837145
dbEST ID: 79654847
Trimmed Sequence: ATGGTGGGACTGAATGGCCGGGAGAAGGCGGGATGTCGGCAGCTGCTGGGAGAGATGGAGATCTCCGACCTCATGTCCCTGGCAGAGACCGTCACTAATCGAATGATCCGAGTGTTGAGCAGGGAAGAAGCGGTTGATGCGATATTAACGTACAGCGAGACTGCGGCTGAACTTCTGAGACGCAAGAAGGTTTACCGTGATCTCATATTTAAGTACCTGGCCTCCAAGAAAATACCCGTGTCCCCTTCTAGTGATAAAAATCAGCTCATCCAGCACACCCTGGAGTTCTGGAGAGAAACTGCTATAGAGAGTGTTCCCCCACCACCCGAGAGTAGTAACGTAAATGAACAAAACTCACAGGAGAAGAGCAATTCCACCTCACATCGCGCTTCACTGGACTGTCAAATGCTTGGGGAACATTTCTGCAGGTGGTTTTATGAACTCTTAAACTCACAGAATCCAGTACTTGGCCTTGAAAAGGGTGATTGGGGACCTCAACACTTCTGGGAGAATGCCATGCTTAGATTTGCCTATAGTACATCACAAGACAATACAAAAGAGCACAATGGGGCCCAGATGACAAGCTTGCGTCTACTCGCACTCCCACCGGAAGAGAGACTGCGGGTCGGCCCAAACATTGATACTGGTGGGCTTGGAATGGGTCACTTCTCCCCTTGCTTTGGTGGGGTTGTGCAGTGGGTGGGAACATCCCCCCTCCAACAATCAGGGTTTTGGCCATATTTGAAAAAACCTCTTTTGGGAATATTCCCCCCTCGCCCCGGTGCCCACACCAACCCGGGGAGAAAA
Full Trace Sequence: GGCCCCCAATAATAGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGGACTGAATGGCCGGGAGAAGGCGGGATGTCGGCAGCTGCTGGGAGAGATGGAGATCTCCGACCTCATGTCCCTGGCAGAGACCGTCACTAATCGAATGATCCGAGTGTTGAGCAGGGAAGAAGCGGTTGATGCGATATTAACGTACAGCGAGACTGCGGCTGAACTTCTGAGACGCAAGAAGGTTTACCGTGATCTCATATTTAAGTACCTGGCCTCCAAGAAAATACCCGTGTCCCCTTCTAGTGATAAAAATCAGCTCATCCAGCACACCCTGGAGTTCTGGAGAGAAACTGCTATAGAGAGTGTTCCCCCACCACCCGAGAGTAGTAACGTAAATGAACAAAACTCACAGGAGAAGAGCAATTCCACCTCACATCGCGCTTCACTGGACTGTCAAATGCTTGGGGAACATTTCTGCAGGTGGTTTTATGAACTCTTAAACTCACAGAATCCAGTACTTGGCCTTGAAAAGGGTGATTGGGGACCTCAACACTTCTGGGAGAATGCCATGCTTAGATTTGCCTATAGTACATCACAAGACAATACAAAAGAGCACAATGGGGCCCAGATGACAAGCTTGCGTCTACTCGCACTCCCACCGGAAGAGAGACTGCGGGTCGGCCCAAACATTGATACTGGTGGGCTTGGAATGGGTCACTTCTCCCCTTGCTTTGGTGGGGTTGTGCAGTGGGTGGGAACATCCCCCCTCCAACAATCAGGGTTTTGGCCATATTTGAAAAAACCTCTTTTGGGAATATTCCCCCCTCGCCCCGGTGCCCACACCAACCCGGGGAGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGGACTGAATGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837144
dbEST ID: 79654846
Trimmed Sequence: GTTATAAAAGTTTTCTAAATCGCTAGTTTTATACTGAATAGATGGTCTCGGCACTGAGCCCACAGCGCTCTGTCCCAAGATTTTCAGATTAACATTTTTGATCTTCCAGCTGTCAGTAACCGGGCAGCGGATTAGTCCAAAGAGCTGTTCAAATATGCCCAAACATTGATTGTCCCTGTGGATTGTACCAGCCACTGCTACAACCACCAAACCATGTGGAGAAGTGACACATTTCAAGCCCCCAGTATCAATGTTTGGGTTGAACAGCAGTCTCTCCTCCCGTGTGAGTGCGAGTAGACGCAAGCTTGTCATCTGGGCCCCATTGTGCTCTTCTGTATTGTCTTGTGATGTACTATAGGCAAATTTAAGCATGGCATTCTCCCAGAAGTGCTGAGGTCCCCAATCACCCTTTTCAAGGCCGAGTACTGGATTCTGTGAGTTTAAGAGTTCATAAAACCACCTGCAGAGATGTTCCCCCAACATTTTACAGTCCAATGAAACGCGATGTGAGGTGGAATTGCTCTTCTCCTTTGAATATTGTTCATTTAGCTTACTACTCTCCGGGGGGGGGGG
Full Trace Sequence: GGGGAAACTGCTATAGACCATGTAATACGACTCACTATANGGGGATGATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTATAAAAGTTTTCTAAATCGCTAGTTTTATACTGAATAGATGGTCTCGGCACTGAGCCCACAGCGCTCTGTCCCAAGATTTTCAGATTAACATTTTTGATCTTCCAGCTGTCAGTAACCGGGCAGCGGATTAGTCCAAAGAGCTGTTCAAATATGCCCAAACATTGATTGTCCCTGTGGATTGTACCAGCCACTGCTACAACCACCAAACCATGTGGAGAAGTGACACATTTCAAGCCCCCAGTATCAATGTTTGGGTTGAACAGCAGTCTCTCCTCCCGTGTGAGTGCGAGTAGACGCAAGCTTGTCATCTGGGCCCCATTGTGCTCTTCTGTATTGTCTTGTGATGTACTATAGGCAAATTTAAGCATGGCATTCTCCCAGAAGTGCTGAGGTCCCCAATCACCCTTTTCAAGGCCGAGTACTGGATTCTGTGAGTTTAAGAGTTCATAAAACCACCTGCAGAGATGTTCCCCCAACATTTTACAGTCCAATGAAACGCGATGTGAGGTGGAATTGCTCTTCTCCTTTGAATATTGTTCATTTAGCTTACTACTCTCCGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATAAAAGTTTTCTAAATCGCT