ORFeome > c6orf120 ORF1 – XORFeome v1.0

c6orf120 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c6orf120
Gene ID: 6253959
Gene Page ID: 963424
ORF Xenbase ID: 17267223

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC084835
Original XGC clone length: 210

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ840034
dbEST ID: 79657736
Trimmed Sequence: ATGGAAAGTGAATTTGAATTAAAGGTCTACTTTGACCGAAAGCTGCGAGCTGACCCTTTTGCTGAAGCATCTTTTGACCCAGAGAAGCTGGGGGGAAATCAGAAACAACAACAGCAACAAACATCTCTGGATTCATCTCAGGAGGAAGAATCTATTCTATGGACTATATTAATAGGGATTTTAAAAATAGTTCTCGAAATTCTTTTCTT
Full Trace Sequence: GGGGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAGTGAATTTGAATTAAAGGTCTACTTTGACCGAAAGCTGCGAGCTGACCCTTTTGCTGAAGCATCTTTTGACCCAGAGAAGCTGGGGGGAAATCAGAAACAACAACAGCAACAAACATCTCTGGATTCATCTCAGGAGGAAGAATCTATTCTATGGACTATATTAATAGGGATTTTAAAAATAGTTCTCGAAATTCTTTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGACCGATATCCCCGATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAAACAAAAAAAAAACATTTTTATTTGATTACGGCAAAGCCGGGGGCAAAAGGAGGGAAAGGGTCATCCGGACCAGGGGGAAAGGGTGGGGCTTGTGTTGTTAGGAAAGGTGGCCGGGGGCACGAAAATAGGCGAGGAGGGGGTTGGGACTTATGAAGAGGGGCAGAGGGGCGGTGCCGTGGTAAACAATATAGACAAAAACCCGGGGGGGCCCCGGCCAGGGGGGGCTTAAGAGTTTGCTAAAAGTTTTTTTGGGGGAAAGGGGCGCCGCGGGTCTCCCCGGGCACGGCAAAAACCCGCTTGTTTGGGGGGGAGGATTTTTGTGGCCAAAGAAAAAACTACAAAAAGAGGGGGCCGCCCCCCGCGCCCCGGGGGGAAAAAAGATATATAGAAATAAGTGAGACACAACACCCACAACCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAGTGAATTTGAATTAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ840033
dbEST ID: 79657735
Trimmed Sequence: GAAAAGAATTTCGAGAACTATTTTTAAAATCCCTATTAATATAGTCCATAGAATAGATTCTTCCTCCTGAGATGAATCCAGAGATGTTTGTTGCTGTTGTTGTTTTTGATTTGCCCCCAGCTTCTCTGGGTCAAAAGATGCTTCAGCAAAAGGGTCAGCTCGCAGCTTTCGGTCAAAGTAGACCTTTAATTCAAATTCACTTTCCATGG
Full Trace Sequence: GAAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAAGAATTTCGAGAACTATTTTTAAAATCCCTATTAATATAGTCCATAGAATAGATTCTTCCTCCTGAGATGAATCCAGAGATGTTTGTTGCTGTTGTTGTTTTTGATTTGCCCCCAGCTTCTCTGGGTCAAAAGATGCTTCAGCAAAAGGGTCAGCTCGCAGCTTTCGGTCAAAGTAGACCTTTAATTCAAATTCACTTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAAGCTTAATACTGTCCGTCGTAATACAACAGAACAACCGTATCTCATGACTCAGCGACAGCAGGGCCGACGGAAAAGGGAAGGGTTCGGTGCGAGCACTGGATCGTTGGGTGTATCTAGCGGTCGACGGGGAAGAGGGGGCCGACCTACTGCAAAACGGCGGGTCGGGGGGGGAGACGGAATAAAAGTAGAAAAGGAGGCCGCCCGGTGGGCAAAATGCTAGGGCGAAAGACAGGAGGGGCCGGGGGGGTGGGGGTTAATCGTTTGATAGAACTTTTTTTTGGGTAAAGCTCCAAGTCCGGGCTCCCAGGCCGGGGCGCCGTACCGCTGGGGTCGGTTTGGTTGTTGTGTACTGGGGCAAATCTAAAACAGCAGGCGGGCCCCCCCCGCAGAGGTGCAGGTTTTGGGGATAGTGGGGGGGGCGGCGCGAAGGTGCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAAGAATTTCGAGAACTAT