ORFeome > c6orf136 ORF1 – XORFeome v1.0

c6orf136 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c6orf136
Gene ID: 865711
Gene Page ID: 487541
ORF Xenbase ID: 17267229

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129655
Original XGC clone length: 537

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ837831
dbEST ID: 79655533
Trimmed Sequence: ATGGAACAACTGCTGGCTGTGGTGCATGCCAAGCTCAGGGAAGAGCTGCCAAATTTCTTGTTGAAAACTATGGATTACTCAATATACAAAAAGGATGTGGAATTTGTCAGCAATGTCCTGCATATACATACACGAGGTGTGATGTTATATCAGCTACTTCTGACACTGTCGCGGTTTTTGTTCTTGAGTTACTTATCCAATGCTCGTGTCTCTATCTTGAAACTGACATCTCACCCCGAAACATCTANTATCCAAGCTCGTTGGGCAATCTCAGGCCTTCCTCTTCACACTCTTCTCCTCCACTTCTATCGTAATGACAAGACAGAGCTTTACAAGTCATTTGATGCTCACTCCACCTTTTACTTGGCCTCAGATGGTCTAATACGTCTACCTAGATTGGAGCGGGTGATGCCTTCTCAGCCACTTACTGTACCCAAGAAGAATCTTCTCACTGCTGCACTCGTAACCTTAGGGCTTTAGGAGAAGATCGTTCCTGCACTCAATTTACTATCTTTCCCTAAAGCATCTCCAAAGCTTTTTCCAACTTTTCTTGTAACAAATTTGACATTATAAAAAAAGCATTGCTTTATAATATTATTTGCAACGAACAGATCACTAATCGGTTCAAAAAAAAAATCCTTTATTTGCCAATCCAGCTAAAAAACCCCTCANNNGGANNCANAATTACNTGNGNNTNGAGGAGAAAAAAAAAAAAAAAATATATATATAATACACGAAGGCCCGCGAACGCCAACAAAAAAAAAGAAAGGGGCAGCCTTGTTGANACCGCACGGGTTGCGTGCGGTNGGATAACAGNAGNGTGNGANAGAAGAGAATAANAAAGAG
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACAACTGCTGGCTGTGGTGCATGCCAAGCTCAGGGAAGAGCTGCCAAATTTCTTGTTGAAAACTATGGATTACTCAATATACAAAAAGGATGTGGAATTTGTCAGCAATGTCCTGCATATACATACACGAGGTGTGATGTTATATCAGCTACTTCTGACACTGTCGCGGTTTTTGTTCTTGAGTTACTTATCCAATGCTCGTGTCTCTATCTTGAAACTGACATCTCACCCCGAAACATCTANTATCCAAGCTCGTTGGGCAATCTCAGGCCTTCCTCTTCACACTCTTCTCCTCCACTTCTATCGTAATGACAAGACAGAGCTTTACAAGTCATTTGATGCTCACTCCACCTTTTACTTGGCCTCAGATGGTCTAATACGTCTACCTAGATTGGAGCGGGTGATGCCTTCTCAGCCACTTACTGTACCCAAGAAGAATCTTCTCACTGCTGCACTCGTAACCTTAGGGCTTTAGGAGAAGATCGTTCCTGCACTCAATTTACTATCTTTCCCTAAAGCATCTCCAAAGCTTTTTCCAACTTTTCTTGTAACAAATTTGACATTATAAAAAAAGCATTGCTTTATAATATTATTTGCAACGAACAGATCACTAATCGGTTCAAAAAAAAAATCCTTTATTTGCCAATCCAGCTAAAAAACCCCTCANNNGGANNCANAATTACNTGNGNNTNGAGGAGAAAAAAAAAAAAAAAATATATATATAATACACGAAGGCCCGCGAACGCCAACAAAAAAAAAGAAAGGGGCAGCCTTGTTGANACCGCACGGGTTGCGTGCGGTNGGATAACAGNAGNGTGNGANAGAAGAGAATAANAAAGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACAACTGCTGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837830
dbEST ID: 79655532
Trimmed Sequence: AAGCTTGGGAGATGCTTTAGGGGAAGATAGTAAATTGAGTGCAGGACGATCTTCTCCCAAGCCCAAGGCTACGAGTGCAGCAGTGAGAAGAGTCTTCTTGGGTACAGTAAGTGGCTGAGAAGGCATCACCCGCTCCAATTTATGTAGACGTATTAGACCATCTGAGGCCAAGTAAAAGGTGGAGTGAGCATCAAATGACTTGTAAAGCTCCGTCTTGTCATTACGATAGAAGTGGAGGAGAAGAGTGTGAAGAGGAAGGCCTGAGATTGCCCAACGAGCTTGGATACTAGATGTTTCGGGGTGAGATGTCAGTTTCAAGATAGAGACACGAGCATTGGATAAGTAACTCAAGAACAAAAACCGCGACAGTGTCAGAAGTAGCTGATATAACATCACACCTCGTGTATGTATATGCAGGACATTGCTGACAAATTCCACATCCTTTTTGTATATTGAGTAATCCATAGTTTTCAACAAGAAATTTGGCAGCTCTTCCCTGAGCTTGGCATGGCACCACAGCCAGCAGTTGTTCCATGG
Full Trace Sequence: GGCCAGGGAACAGCTTATGACCATGTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGCTTGGGAGATGCTTTAGGGGAAGATAGTAAATTGAGTGCAGGACGATCTTCTCCCAAGCCCAAGGCTACGAGTGCAGCAGTGAGAAGAGTCTTCTTGGGTACAGTAAGTGGCTGAGAAGGCATCACCCGCTCCAATTTATGTAGACGTATTAGACCATCTGAGGCCAAGTAAAAGGTGGAGTGAGCATCAAATGACTTGTAAAGCTCCGTCTTGTCATTACGATAGAAGTGGAGGAGAAGAGTGTGAAGAGGAAGGCCTGAGATTGCCCAACGAGCTTGGATACTAGATGTTTCGGGGTGAGATGTCAGTTTCAAGATAGAGACACGAGCATTGGATAAGTAACTCAAGAACAAAAACCGCGACAGTGTCAGAAGTAGCTGATATAACATCACACCTCGTGTATGTATATGCAGGACATTGCTGACAAATTCCACATCCTTTTTGTATATTGAGTAATCCATAGTTTTCAACAAGAAATTTGGCAGCTCTTCCCTGAGCTTGGCATGGCACCACAGCCAGCAGTTGTTCCATGGTGCCAACTTTTTTGTACAAGGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTTCAACGAACAAGTTCCTATCAGTTCAAATAAAATCCATATTTGGGGCCCGAAGGGTGGAAAAAAATAAAAAAAAAATAATATAAAAACAGAGGGGAGGCGGACGCCCGCAAAGAAAAAAAGAGCCCATCTGCTGTAGAGGCCCGTGTTTGCGTGTGTNGGTAGTGGGAGAAAAAAAAAAAAAGAAAAAAAAAAAAAGAAAAACGGGATGGGGTTTGAATGGTGGAGGAAAAGNGAGAAGGAGGGNAGGGAAAGGAGAGAGGAGGACGNCGCGNNNGNGCGNGGTTGGGGGGGAAGGAGGGGGGGGNNNNNNNNGNNNNNGAGNGGAAGGGGAGNGGGNGGGGNAGGNNGGGGGGGGGGNGNGGGGGNGAGGGGNGGGNNNNANNGGGNNGGGNNGGNNNNGGGNNGNGGNNGGGGGGNAANGGGNGAGNNGNAGNNNNGGGGNNNGGGGGGNGGNNGGGANGNGGAGGGGGGGGGGGAGGGGNGNAGGGGGGNGGNAAGNGGGGGNNAGGNGGGGGGTNNGNGGNGAGGNAGGGGGGGGGGGGANNNNNNNAAGAAGNGGGANNGANGNGGNGGANAGGGGGNNGGGGGGGAGGGGANGGAGGGNANGGGANNNNGGGGGGGGNNGGGGGGGGGNNNGNAAGNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCTTGGGAGATGCTTTAGGGGA