ORFeome > c7orf10 ORF1 – XORFeome v1.0

c7orf10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c7orf10
Gene ID: 5750709
Gene Page ID: 5750707
ORF Xenbase ID: 17267247

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC097906
Original XGC clone length: 1140

Human orthology & disease relationships

NCBI Entrez ID: 79783
Ensembl gene IDs: ENSG00000175600
Directly associated (OMIM) disease MIM numbers: 231690
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ838439
dbEST ID: 79656141
Trimmed Sequence: ATGATTCTTGTAGATCTTGGAGCCGAGATTATTAAAGTAGAAAGACCAGGACCAGGAGATGATACAAGATCGTGGGGACCTCCTTTTGTTGGAAGTGAGAGTGCTTATTTTCTGAGCGTAAACAGAAATAAGAAGAGTATAGCTGTAAATATGAAAAATCCGAATGGCAGCAAGATTATTCAAGAGCTTGCAAAAGCCTGTGATGTTTTTATTGAAAATTACATTCCAGGCAAGCTATCTAAGATGGGACTTGGATTTGAGGAGATAAAGGAAATTGCTCCTCATATAATTTACTGCTCAATAACTGGCTACGGCCAGACAGGCCCTTTGTTTCAAAGAGCTGGATATGATGCAGTTGCCTGTGCAATGTCTGGACTTATGTACATCACAGGACCCGAGGATGGGGATCCAGTGCGCCCAGGAGTAGCTATGACAGACCTTGCTACTGGATTGTTTGCTCATGGAGCGATTATGGCTGGTTTGCTTCAGAGGTCTAAGACAGGGAAGGGGATGCACATTGACTGCAATCTGCTGTCATCACAGGTGGCTTGTCTGAGTCATGTTGCAGCAAACTTTCTTAATGGCGGCGCTGAAGCAAACGCTGGGGAACTGCGCATGGAAGCATTGGTTCCTATCACTCCTTTAAATCCAAGGACGGGTACCTAATAATTGGGGGCGGGAGCAGATCAACAATTCTCTACTGTTTTGCAGAAGAT
Full Trace Sequence: CGCGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCTTGTAGATCTTGGAGCCGAGATTATTAAAGTAGAAAGACCAGGACCAGGAGATGATACAAGATCGTGGGGACCTCCTTTTGTTGGAAGTGAGAGTGCTTATTTTCTGAGCGTAAACAGAAATAAGAAGAGTATAGCTGTAAATATGAAAAATCCGAATGGCAGCAAGATTATTCAAGAGCTTGCAAAAGCCTGTGATGTTTTTATTGAAAATTACATTCCAGGCAAGCTATCTAAGATGGGACTTGGATTTGAGGAGATAAAGGAAATTGCTCCTCATATAATTTACTGCTCAATAACTGGCTACGGCCAGACAGGCCCTTTGTTTCAAAGAGCTGGATATGATGCAGTTGCCTGTGCAATGTCTGGACTTATGTACATCACAGGACCCGAGGATGGGGATCCAGTGCGCCCAGGAGTAGCTATGACAGACCTTGCTACTGGATTGTTTGCTCATGGAGCGATTATGGCTGGTTTGCTTCAGAGGTCTAAGACAGGGAAGGGGATGCACATTGACTGCAATCTGCTGTCATCACAGGTGGCTTGTCTGAGTCATGTTGCAGCAAACTTTCTTAATGGCGGCGCTGAAGCAAACGCTGGGGAACTGCGCATGGAAGCATTGGTTCCTATCACTCCTTTAAATCCAAGGACGGGTACCTAATAATTGGGGGCGGGAGCAGATCAACAATTCTCTACTGTTTTGCAGAAGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCTTGTAGATCTTGGAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838438
dbEST ID: 79656140
Trimmed Sequence: GTTGACCACATTTTGAGCCACTATTTCAGCTTTAATCAGTTCATTGATATGGGAATCTTCATATCCCAAAATATTTTTCAGAACCTCAGTGGTGTGCTGTCCAATGAGAGGAGGTGGGTTTGGCTTGGAAATATTGAATCCACTGAATCTTACAGCAGGGCCTGGAACAGATATTTTCCCTGCTGTAGGATGATCCATGTCTAAAACAAGGCCATTGTGTATAACCTGGGGTTCACAGAAGACTTGTTTAATACTGTTAATTGGACCATATGGAATGCCACTACCTTCCAAGAGATTTAGCCATTCACTGGTTGTTTTTTCTGAGAAGCGTGCTGAGAATATAATTAGGAGAGCATTTCTGTTCTGGACGCTAAATTTGTTAGTCTGAGATCTACGATCCGCGGGGAGGGCAGTTAATGCCACGAACTTGGGGGGGGTGAGAAAGAAGTGAAACGTTGGCGGGGCGGGGGCACTAAAATACGGGACCTTGGAATTGAGAAGAGGGGGATGGAGCAGGGATTTGGGGCAGCTTTGCCCAGCTGGGGGGGGGTGCGGGCCCCATTAGGAGAGGTTGAGTGGGGGGGGGGTCTGAAAAAACAACATCTTGATAAAGGAAGGGGAGGGTCGAGTGTGGGTGGGGGGGGGGGGGGCGGGTGACATTGTTATGCTTTCGGGTGAGGAGAAAAAACGAAAGAAGGAGGGAAGAGCGGGCAGACACCGCTGGCT
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGACCACATTTTGAGCCACTATTTCAGCTTTAATCAGTTCATTGATATGGGAATCTTCATATCCCAAAATATTTTTCAGAACCTCAGTGGTGTGCTGTCCAATGAGAGGAGGTGGGTTTGGCTTGGAAATATTGAATCCACTGAATCTTACAGCAGGGCCTGGAACAGATATTTTCCCTGCTGTAGGATGATCCATGTCTAAAACAAGGCCATTGTGTATAACCTGGGGTTCACAGAAGACTTGTTTAATACTGTTAATTGGACCATATGGAATGCCACTACCTTCCAAGAGATTTAGCCATTCACTGGTTGTTTTTTCTGAGAAGCGTGCTGAGAATATAATTAGGAGAGCATTTCTGTTCTGGACGCTAAATTTGTTAGTCTGAGATCTACGATCCGCGGGGAGGGCAGTTAATGCCACGAACTTGGGGGGGGTGAGAAAGAAGTGAAACGTTGGCGGGGCGGGGGCACTAAAATACGGGACCTTGGAATTGAGAAGAGGGGGATGGAGCAGGGATTTGGGGCAGCTTTGCCCAGCTGGGGGGGGGTGCGGGCCCCATTAGGAGAGGTTGAGTGGGGGGGGGGTCTGAAAAAACAACATCTTGATAAAGGAAGGGGAGGGTCGAGTGTGGGTGGGGGGGGGGGGGGCGGGTGACATTGTTATGCTTTCGGGTGAGGAGAAAAAACGAAAGAAGGAGGGAAGAGCGGGCAGACACCGCTGGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGACCACATTTTGAGCC