ORFeome > c7orf25 ORF1 – XORFeome v1.0

c7orf25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c7orf25
Gene ID: 5848830
Gene Page ID: 5848799
ORF Xenbase ID: 17267253

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124981
Original XGC clone length: 1275

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ837519
dbEST ID: 79655221
Trimmed Sequence: ATGTCCGTTGACTCAATGCTTTGTGACCGTATAGACATTGCCAAACAGCTGATTAAAAGATCTGAAGCACTTTCCAGATCTCGAGTCGGTGGAGTGGAAGGCGGAGCAAAACTGTGCAGCAAACTGAAAGCAGAGTTGAAGTTTTTACAAAAAGTCGAGGCAGGAAAAGTAGCCATTAAAGAGTCTCACCTGCGAAGCACAAACCTCACACATCTGCAAGCTGTTATTGAATCTGCAGAGAGCTTGGAAGAGGTTGTCAGCGTTCTTCATGTCTTTAGCTATAATGATCAGTTCGGAGAGAAGCAGTCACTGGTGGTTGATGTTGTTGCGAATGGCGGGCACACTTGGGTGAGAGCAATTGGGCGGAAAGCTGAAGCACTGCACAACATATGGCTGGGGCGGGGTCAGTATGGAGACAAGAGCGTTATAAAACAGGCAGAAGATTATTTACTACCCAGCTCTCAACAGCTGGGTCAGTACAGCAGCCCACATATCATATTTGCCTTTTACAATAGTGTCTCTAAACCTATGGCTGAGGAGTTGAAAGAGATTGGCATCTCTGTACGTGGTGGATGTTGTTGCTGGTGGTACCTCTTCCCAAGATTTACCAGAGGAAGAACAATTTAATTTGTAGGCGAATCAGAACTGTTGTGGGGGAGGAAGCTGGCGGGCCTCCCCTCTCACCCCCACTACAAAACATAAAAAACACATAAAAATATCAATTGCTTTTCTCTCCCGTATAATTCAAGGGAGGGGGAGGAGGGGGACCCGCGCTCGTCCTTTCTT
Full Trace Sequence: GGGGGGCCCAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGTTGACTCAATGCTTTGTGACCGTATAGACATTGCCAAACAGCTGATTAAAAGATCTGAAGCACTTTCCAGATCTCGAGTCGGTGGAGTGGAAGGCGGAGCAAAACTGTGCAGCAAACTGAAAGCAGAGTTGAAGTTTTTACAAAAAGTCGAGGCAGGAAAAGTAGCCATTAAAGAGTCTCACCTGCGAAGCACAAACCTCACACATCTGCAAGCTGTTATTGAATCTGCAGAGAGCTTGGAAGAGGTTGTCAGCGTTCTTCATGTCTTTAGCTATAATGATCAGTTCGGAGAGAAGCAGTCACTGGTGGTTGATGTTGTTGCGAATGGCGGGCACACTTGGGTGAGAGCAATTGGGCGGAAAGCTGAAGCACTGCACAACATATGGCTGGGGCGGGGTCAGTATGGAGACAAGAGCGTTATAAAACAGGCAGAAGATTATTTACTACCCAGCTCTCAACAGCTGGGTCAGTACAGCAGCCCACATATCATATTTGCCTTTTACAATAGTGTCTCTAAACCTATGGCTGAGGAGTTGAAAGAGATTGGCATCTCTGTACGTGGTGGATGTTGTTGCTGGTGGTACCTCTTCCCAAGATTTACCAGAGGAAGAACAATTTAATTTGTAGGCGAATCAGAACTGTTGTGGGGGAGGAAGCTGGCGGGCCTCCCCTCTCACCCCCACTACAAAACATAAAAAACACATAAAAATATCAATTGCTTTTCTCTCCCGTATAATTCAAGGGAGGGGGAGGAGGGGGACCCGCGCTCGTCCTTTCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGTTGACTCAATGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837518
dbEST ID: 79655220
Trimmed Sequence: GAGTAGATTGGAAGATGCATAATTATTGGGTAAAGGGGTGGCTGAAGATTCTTTACTTTCGGTTAGAGCTCGAGGCTGATGTATAAACACACTGAACTTGACTCCCTGGTTTGCTGCAGCCCTTACAAAACCACTATTGGCAGTCATTGTGATGGCTTTTAAGGTCTCCCCAGTCCCAAAGATAGAAATGGAACGGCTGTTTATTTTGGAGCTACAAGCAAGTTTTGAGGCACGCTCAGAAGGCTGGTCTGGTACCACAGTAATACTCTTTACTAGCAATGCAGCTCTTTCTTTTTCTGCTGGTCCACCCAAGGTCTCCAGTATTGACTGGAAATCCTTTATCGCGCTTTCACATGCAAACAATTCTTTGGCTTCCATAAATGACTTAAGCAGTGGAAGCACCTTTTCTTGCCTTTCTTGTGCTGCCTGCTCTGTTAAGACTTTTTCTTTAAATAACCAATGGCAACCTCCATGGCTCAGAGCGGATACATAGGTAATTAAAGTAGTGATATCTAAATTAACCCGTTTGCATGCCTCTACCTTGATCTCTGTAAGGAAAGCAATGCTAGCTACTATGTTTTCAATATCTACTTTGCTGACATGGAGGGACAGGAGTGTCATCCCCCATCACAATCAGAATTCCCTTCCACTTAATTATTTCCTCCTCTGGTTAATTTTTCTTGGGAAGAGTATTAAAGGCGAGAAATACCCCCCGCCTAACAAAGAATCCCAAACCTCTTTTTCACCTTTTTTCTGCCCCTAAGGTTTTTAGAAAAAGGC
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGTAGATTGGAAGATGCATAATTATTGGGTAAAGGGGTGGCTGAAGATTCTTTACTTTCGGTTAGAGCTCGAGGCTGATGTATAAACACACTGAACTTGACTCCCTGGTTTGCTGCAGCCCTTACAAAACCACTATTGGCAGTCATTGTGATGGCTTTTAAGGTCTCCCCAGTCCCAAAGATAGAAATGGAACGGCTGTTTATTTTGGAGCTACAAGCAAGTTTTGAGGCACGCTCAGAAGGCTGGTCTGGTACCACAGTAATACTCTTTACTAGCAATGCAGCTCTTTCTTTTTCTGCTGGTCCACCCAAGGTCTCCAGTATTGACTGGAAATCCTTTATCGCGCTTTCACATGCAAACAATTCTTTGGCTTCCATAAATGACTTAAGCAGTGGAAGCACCTTTTCTTGCCTTTCTTGTGCTGCCTGCTCTGTTAAGACTTTTTCTTTAAATAACCAATGGCAACCTCCATGGCTCAGAGCGGATACATAGGTAATTAAAGTAGTGATATCTAAATTAACCCGTTTGCATGCCTCTACCTTGATCTCTGTAAGGAAAGCAATGCTAGCTACTATGTTTTCAATATCTACTTTGCTGACATGGAGGGACAGGAGTGTCATCCCCCATCACAATCAGAATTCCCTTCCACTTAATTATTTCCTCCTCTGGTTAATTTTTCTTGGGAAGAGTATTAAAGGCGAGAAATACCCCCCGCCTAACAAAGAATCCCAAACCTCTTTTTCACCTTTTTTCTGCCCCTAAGGTTTTTAGAAAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGTAGATTGGAAGATGCATAATT