ORFeome > c7orf57 ORF1 – XORFeome v1.0

c7orf57 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c7orf57
Gene ID: 5935839
Gene Page ID: 5935826
ORF Xenbase ID: 17267271

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123129
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ838032
dbEST ID: 79655734
Trimmed Sequence: ATGAAAGAATTGTTAAAAGAAACTTCTGGTCCTCCAACCCGATATGCTACTTGCGAATGGTTTTACCACGCGCCAATGAACCAAGCAGATAAGTCAGCCAGAGCTGCTCCCCTTCCTCCCACATCTCAAGTTCCAGGTTTGAGTGATCTTGCAGAACCTCATAATGAGTCTTTTAATCAGAGTCGCAAAAAGTGGATTAAGGAGACTGACTCGGATTATGTCAAACTGGCCAAACAAGGAGGTCGACCAGACTTGTTGAAACAAATTGAAAATACAACAAAGAAGTCATCTTCAGTATGCCACGCCCTTCCAGAATGGTATACACATATGACTGAAAATTCACCAGCTGAACAGAGAGAACCTCCTTTAAGAAATATTCCAGATTATATGGTTCATGAAGACTTCAATACAAGTCAGCATGAACAATCATATGAAGTTAAAAGGGGCCCTTTTGATTTTGATCAGAAATCTGTTTGGCAGAGGGATTCTGATGGTGTCATTAAAGAAAATCATGATGATAAAAAGCAGGTGAAGCTACCAGACATAAAAACAAGGTCTAAGGGTGATACCAAAACCTTTCTTGGCAAAGGGCCTCCCACAACCAATGCTAAAAAGGCAACATCTGGGAAAAAAAGTGCTTATTCCCACCTATGCCAGTGTCTCAGAAGAAAAAGAACGGTTTTGCCACCTTCCTTGTTACAAGTTGGCAATATAAGAAAACAATTGTTTAACATTTTGGTTTTGCACGAAGCGGGT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAAGAATTGTTAAAAGAAACTTCTGGTCCTCCAACCCGATATGCTACTTGCGAATGGTTTTACCACGCGCCAATGAACCAAGCAGATAAGTCAGCCAGAGCTGCTCCCCTTCCTCCCACATCTCAAGTTCCAGGTTTGAGTGATCTTGCAGAACCTCATAATGAGTCTTTTAATCAGAGTCGCAAAAAGTGGATTAAGGAGACTGACTCGGATTATGTCAAACTGGCCAAACAAGGAGGTCGACCAGACTTGTTGAAACAAATTGAAAATACAACAAAGAAGTCATCTTCAGTATGCCACGCCCTTCCAGAATGGTATACACATATGACTGAAAATTCACCAGCTGAACAGAGAGAACCTCCTTTAAGAAATATTCCAGATTATATGGTTCATGAAGACTTCAATACAAGTCAGCATGAACAATCATATGAAGTTAAAAGGGGCCCTTTTGATTTTGATCAGAAATCTGTTTGGCAGAGGGATTCTGATGGTGTCATTAAAGAAAATCATGATGATAAAAAGCAGGTGAAGCTACCAGACATAAAAACAAGGTCTAAGGGTGATACCAAAACCTTTCTTGGCAAAGGGCCTCCCACAACCAATGCTAAAAAGGCAACATCTGGGAAAAAAAGTGCTTATTCCCACCTATGCCAGTGTCTCAGAAGAAAAAGAACGGTTTTGCCACCTTCCTTGTTACAAGTTGGCAATATAAGAAAACAATTGTTTAACATTTTGGTTTTGCACGAAGCGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGAATTGTTAAAAGAAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838031
dbEST ID: 79655733
Trimmed Sequence: ACGGTCTCTTTCTTTTGAGACACTGGCATAGGTGGGAATAAGCACTTTTTTTCCAGATGTTGCCTTTTTAGCATTTGTTGTGGGAGGCCCTTTGCCAAGAAAGGTTTTGGTATCACCCTTAAACCTTGTTTTTATGTCTGGGAGCTTCACCTGCTTTTTATCATCATGATTTTCTTTAATGACACCATCAGAATCCCTCTGCCAAACAGATTTCTGATCAAAATCAAAAGGGGCCCTTTTAACTTCCTATAATTGTTCATGCTGACTTGTATTGAAGTCTTCATGAACCATATAATCTGGAATATTTCTTAAAAGAAGTTCTCTCTGTTCGGCTGGGGAGTTTTCACTCATATATTTATACCATTCTCGAAGGGCGGGGGGGGCTGAAGAAAAGGGGGTTTTTTTATGTTGCATTAGTTTGAGCAAGGTCGGGGCGGCGGCCATGTGGGTGGCGGTGTGACAAAAACAGAATCAAACACCTGGGTCCACGGTGTTTGACTTCGATTAGGAGAAGGTGGGAAACTAACTGCTTCAAGAGGGGCGCGGCCNAACAGGGGGGTTGGGGAGGGGGGGGGGGGGGGCGCCCCGCAGGGGCTCCTCTTTGGGGTGGGGGGGGGGGGAGGAGGGCGACCCGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAAAAAATGTTGGAGGAATTTGTGGCGGAGGGCGCAGTGGAGA
Full Trace Sequence: GAAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGTCTCTTTCTTTTGAGACACTGGCATAGGTGGGAATAAGCACTTTTTTTCCAGATGTTGCCTTTTTAGCATTTGTTGTGGGAGGCCCTTTGCCAAGAAAGGTTTTGGTATCACCCTTAAACCTTGTTTTTATGTCTGGGAGCTTCACCTGCTTTTTATCATCATGATTTTCTTTAATGACACCATCAGAATCCCTCTGCCAAACAGATTTCTGATCAAAATCAAAAGGGGCCCTTTTAACTTCCTATAATTGTTCATGCTGACTTGTATTGAAGTCTTCATGAACCATATAATCTGGAATATTTCTTAAAAGAAGTTCTCTCTGTTCGGCTGGGGAGTTTTCACTCATATATTTATACCATTCTCGAAGGGCGGGGGGGGCTGAAGAAAAGGGGGTTTTTTTATGTTGCATTAGTTTGAGCAAGGTCGGGGCGGCGGCCATGTGGGTGGCGGTGTGACAAAAACAGAATCAAACACCTGGGTCCACGGTGTTTGACTTCGATTAGGAGAAGGTGGGAAACTAACTGCTTCAAGAGGGGCGCGGCCNAACAGGGGGGTTGGGGAGGGGGGGGGGGGGGGCGCCCCGCAGGGGCTCCTCTTTGGGGTGGGGGGGGGGGGAGGAGGGCGACCCGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAAAAAATGTTGGAGGAATTTGTGGCGGAGGGCGCAGTGGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGTCTCTTTCTTTTGAGACA