ORFeome > c9 ORF1 – XORFeome v1.0

c9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: c9
Gene ID: 968665
Gene Page ID: 968659
ORF Xenbase ID: 17267295

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054952
Original XGC clone length: 1782

Human orthology & disease relationships

NCBI Entrez ID: 735
Ensembl gene IDs: ENSG00000113600,LRG_32
Directly associated (OMIM) disease MIM numbers: 613825,615591
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,123500,215600

Library Location

Plate ID: GDExl11001
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ839174
dbEST ID: 79656876
Trimmed Sequence: ATGGAAAACATATGCTTATTGCTGGGACTAACCGTTCTCTGTGCGTTTGTCTCCGGGGAGCCAAGTTTTTCACAGAACCCCCAGCGGTTCCAGAGAGAAGTGAATGCCCCAGCGCCTATTGACTGCCAGCTAAGCTCTTGGGGCAGTTGGAGCCAATGCGACCCTTGCACCAAACACAGGTATCGGTCTAGGAGTGTGGAGCACTTCGGTCAGTATGGAGGGGCGGCCTGTGTGAATACCCTGGGTGACATTCAACGGTGCATTCCTGAGGAGGATTGTTTAGAACAACCCGTTTTGTGTGGAAATGATTTTGAGTGTGAATCAGGAAGATGCATCAAGACCAGGTTGTTGTGCAATGGGGATAATGACTGTGGAGATTACTCTGACGAAACCTGTGATGATAAAGATCCCAAGTCCCCCTGTCTAAACTCAGATATTGAACTGTCAGAAATTGCAAGAACTGCACGAGACGGGCTGAACATCCTAGGTATGAAACCAAGAAGAAACCCATTTGACAATGAATAAATCAATGGCATTTGTGATAGGGTGCGTGATGGCATAAACATATTTCAGAAAGCCATGGAATAGGGCAGCCTCTTGTTAATAAACTAAAACTAAGAAATCCTTTACAACGAAAACAATCACGATGCCAAATCCGTGAATCCAAGAATTATTGGATGGACTCAACGCCAAT
Full Trace Sequence: GGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAACATATGCTTATTGCTGGGACTAACCGTTCTCTGTGCGTTTGTCTCCGGGGAGCCAAGTTTTTCACAGAACCCCCAGCGGTTCCAGAGAGAAGTGAATGCCCCAGCGCCTATTGACTGCCAGCTAAGCTCTTGGGGCAGTTGGAGCCAATGCGACCCTTGCACCAAACACAGGTATCGGTCTAGGAGTGTGGAGCACTTCGGTCAGTATGGAGGGGCGGCCTGTGTGAATACCCTGGGTGACATTCAACGGTGCATTCCTGAGGAGGATTGTTTAGAACAACCCGTTTTGTGTGGAAATGATTTTGAGTGTGAATCAGGAAGATGCATCAAGACCAGGTTGTTGTGCAATGGGGATAATGACTGTGGAGATTACTCTGACGAAACCTGTGATGATAAAGATCCCAAGTCCCCCTGTCTAAACTCAGATATTGAACTGTCAGAAATTGCAAGAACTGCACGAGACGGGCTGAACATCCTAGGTATGAAACCAAGAAGAAACCCATTTGACAATGAATAAATCAATGGCATTTGTGATAGGGTGCGTGATGGCATAAACATATTTCAGAAAGCCATGGAATAGGGCAGCCTCTTGTTAATAAACTAAAACTAAGAAATCCTTTACAACGAAAACAATCACGATGCCAAATCCGTGAATCCAAGAATTATTGGATGGACTCAACGCCAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAACATATGCTTATTGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839173
dbEST ID: 79656875
Trimmed Sequence: TTTTTCACATGGGATTGTTTTGGTCTGTGACCCATGACATGTTTTACCGCCCTGTTGTGGAACTGGGTTGTCACATTTGCGGGTGGCAGTCAAATCTCCATTAACGCAATTAGGTGAAACAGTCCAACATCCCCATCCGCCATCAATGGGCTCTTTTGGCTTTGAAAAGGCCTCTGCTTTTATATTCTGACATGCCACACCTTCATAGTGTAGCGGGCATTTACAAATACACTCTCCGTCGACCACCATGGCTTTTCCTCCATTTTGACAACGTTGGCACTTGCAGACACTGTACTCATCAATGTATTCTTCAATGGCTCTCTCCAGATTTCGTGACTTTGTGTAGGCATCTTTAATGTCAGTTGGAATAAGAGAATAAATAGGATTGGGTTTGCTTTTTATCACTGCAGGAGCTTCTTTCCAAGATGAAGCCCACTGAACGTAATCGTTAACATCAGCCACAGGTTGTTTCTTATTAAGTTTTTCTTCAAGAGCTGTTACCTATTCTACGGTTCCTTCCTCAAACAAAGAAATGATGCCTCTCATCACCGGGTTTAAGTTTATTTGAGGGTCTGTTTCTGAATTCACTCCCCCTGGTTTTACTACATCCCCCCTTTATTTTGGGATTAAGAACAAGGGTTCCGCCCCTTCTTGTTTTTTACTCCTAATACCTGCCGTTCTGCCTTTAAATTCTCAGGGCAGTTCCTTTTAAATTCTTTCAATTTGTTTAAT
Full Trace Sequence: GCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTCACATGGGATTGTTTTGGTCTGTGACCCATGACATGTTTTACCGCCCTGTTGTGGAACTGGGTTGTCACATTTGCGGGTGGCAGTCAAATCTCCATTAACGCAATTAGGTGAAACAGTCCAACATCCCCATCCGCCATCAATGGGCTCTTTTGGCTTTGAAAAGGCCTCTGCTTTTATATTCTGACATGCCACACCTTCATAGTGTAGCGGGCATTTACAAATACACTCTCCGTCGACCACCATGGCTTTTCCTCCATTTTGACAACGTTGGCACTTGCAGACACTGTACTCATCAATGTATTCTTCAATGGCTCTCTCCAGATTTCGTGACTTTGTGTAGGCATCTTTAATGTCAGTTGGAATAAGAGAATAAATAGGATTGGGTTTGCTTTTTATCACTGCAGGAGCTTCTTTCCAAGATGAAGCCCACTGAACGTAATCGTTAACATCAGCCACAGGTTGTTTCTTATTAAGTTTTTCTTCAAGAGCTGTTACCTATTCTACGGTTCCTTCCTCAAACAAAGAAATGATGCCTCTCATCACCGGGTTTAAGTTTATTTGAGGGTCTGTTTCTGAATTCACTCCCCCTGGTTTTACTACATCCCCCCTTTATTTTGGGATTAAGAACAAGGGTTCCGCCCCTTCTTGTTTTTTACTCCTAATACCTGCCGTTCTGCCTTTAAATTCTCAGGGCAGTTCCTTTTAAATTCTTTCAATTTGTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTCACATGGGATTGTTTTGGT