ORFeome > c9orf3 ORF1 – XORFeome v1.0

c9orf3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c9orf3
Gene ID: 6254904
Gene Page ID: 986049
ORF Xenbase ID: 17267313

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061666
Original XGC clone length: 864

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11022
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ824886
dbEST ID: 79642588
Trimmed Sequence: ATGGCAACCTGTGCAGAGGATTTGCCACTAATGGCCAACACTAGCCATGTTCTTGTAAAACACTATGGACTGGATCTTGATGTATGTTTTGACACTCAAACTATCCGGGGCAGCATTGTTTTGTTCCTGGAACCTAACACCGGAAATAATGATGGAGGCCCAGTCGTTGAAGAAGACTGCCAATCACAACTGTCAAAACACTGTCGGAACGATGAGACACATGACATTAACCAGACATGTGTGTTACCTGTACGAACCTGCTCATCAAACTCTGGAAACAAAGACTCCGCTGTCTGTGTTATAGGTGAAAGAGATACTTCTCCGAAGTGTGATCACCATGGCAACAGGAAGCAGGCTTCTGGGATTACTAGTTCAGAGAACTGCTGTGACAGAGGGAATCATGGGAGTGAGGATTTTGTTCTGGTGTTGGACTGCTGTGATTTATCTGTGTTAAAGGTCGAAGAGGTGGATGTCACTGCTGTGTTAGGTACTGAAAAATGTATGAGCTCTTCTCAGGAAATTGGTAATTCTAAAGAGCATTTAAGTCTCAGTGCTTGTATTCTATCTGAAATTGAAGCTTTACCTGAAAGCCAATGGAAACAGCAGCTATTTAATTATACTAAGTGTAGCAGGGCACCTGGATGTGGAGATCTTATGTTCATCACTGACACATGGAGCCTGAGAATTAACAAAACAGGAATAAAGATGCCAGCCGACTTCCCCTCTGTGATAAGGATATGGTACCAAACAACAACAAATGGGGAGTTCAAGTGAGTGAACCAAA
Full Trace Sequence: TAATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACCTGTGCAGAGGATTTGCCACTAATGGCCAACACTAGCCATGTTCTTGTAAAACACTATGGACTGGATCTTGATGTATGTTTTGACACTCAAACTATCCGGGGCAGCATTGTTTTGTTCCTGGAACCTAACACCGGAAATAATGATGGAGGCCCAGTCGTTGAAGAAGACTGCCAATCACAACTGTCAAAACACTGTCGGAACGATGAGACACATGACATTAACCAGACATGTGTGTTACCTGTACGAACCTGCTCATCAAACTCTGGAAACAAAGACTCCGCTGTCTGTGTTATAGGTGAAAGAGATACTTCTCCGAAGTGTGATCACCATGGCAACAGGAAGCAGGCTTCTGGGATTACTAGTTCAGAGAACTGCTGTGACAGAGGGAATCATGGGAGTGAGGATTTTGTTCTGGTGTTGGACTGCTGTGATTTATCTGTGTTAAAGGTCGAAGAGGTGGATGTCACTGCTGTGTTAGGTACTGAAAAATGTATGAGCTCTTCTCAGGAAATTGGTAATTCTAAAGAGCATTTAAGTCTCAGTGCTTGTATTCTATCTGAAATTGAAGCTTTACCTGAAAGCCAATGGAAACAGCAGCTATTTAATTATACTAAGTGTAGCAGGGCACCTGGATGTGGAGATCTTATGTTCATCACTGACACATGGAGCCTGAGAATTAACAAAACAGGAATAAAGATGCCAGCCGACTTCCCCTCTGTGATAAGGATATGGTACCAAACAACAACAAATGGGGAGTTCAAGTGAGTGAACCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCTGTGCAGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ830257
dbEST ID: 79647959
Trimmed Sequence: AACTTGTATCTCTGGAACGTGACAGTAGACGGGTATTTCATTTTTTTCTACCCCAGATACTAACCTTCCACTTTGGTCTTTGGTCCACTTCACTGAACTCCCATTTGTTGTTGTTTGGTACCATATCCTTATCACAGAGGGGAAGTCGGCTGGCATCTTTATTCCTGTTTTGTTAATTCTCAGGCTCCATGTGTCAGTGATGAACATAAGATCTCCACATCCAGGTGCCCTGCTACACTTAGTATAATTAAATAGCTGCTGTTTCCATTGGCTTTCAGGTAAAGCTTCAATTTCAGATAGAATACAAGCACTGAGACTTAAATGCTCTTTAGAATTACCAATTTCCTGAGAAGAGCTCATACATTTTTCAGTACCTAACACAGCAGTGACATCCACCTCTTCGACCTTTAACACAGATAAATCACAGCAGTCCAACACCAGAACAAAATCCTCACTCCCATGATTCCCTCTGTCACAGCAGTTCTCTGAACTAGTAATCCCAGAAGCCTGCTTCCTGTTGCCATGGTGATCACACTTCGGAGAAGTATCTCTTTCACCTATAACACAGACAGCGGAGTCTTTGTTTTCAGAGTTTGATGAGCAGGTTCGTACAAGTAACACACATGTCTGGGTAATGTCATGTGTCTCATCGTTCCGACAGTGTTTTTGACGGTTGTGATTGGCAGTCTTCCTTCAACAACTGGGGCCTCCTTCAATTTTTTCCCGGGTTTTTGGTTTCCCGGGAACCAAAACCAAGTGCCTCCCCCGGGAAA
Full Trace Sequence: CCGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTTGTATCTCTGGAACGTGACAGTAGACGGGTATTTCATTTTTTTCTACCCCAGATACTAACCTTCCACTTTGGTCTTTGGTCCACTTCACTGAACTCCCATTTGTTGTTGTTTGGTACCATATCCTTATCACAGAGGGGAAGTCGGCTGGCATCTTTATTCCTGTTTTGTTAATTCTCAGGCTCCATGTGTCAGTGATGAACATAAGATCTCCACATCCAGGTGCCCTGCTACACTTAGTATAATTAAATAGCTGCTGTTTCCATTGGCTTTCAGGTAAAGCTTCAATTTCAGATAGAATACAAGCACTGAGACTTAAATGCTCTTTAGAATTACCAATTTCCTGAGAAGAGCTCATACATTTTTCAGTACCTAACACAGCAGTGACATCCACCTCTTCGACCTTTAACACAGATAAATCACAGCAGTCCAACACCAGAACAAAATCCTCACTCCCATGATTCCCTCTGTCACAGCAGTTCTCTGAACTAGTAATCCCAGAAGCCTGCTTCCTGTTGCCATGGTGATCACACTTCGGAGAAGTATCTCTTTCACCTATAACACAGACAGCGGAGTCTTTGTTTTCAGAGTTTGATGAGCAGGTTCGTACAAGTAACACACATGTCTGGGTAATGTCATGTGTCTCATCGTTCCGACAGTGTTTTTGACGGTTGTGATTGGCAGTCTTCCTTCAACAACTGGGGCCTCCTTCAATTTTTTCCCGGGTTTTTGGTTTCCCGGGAACCAAAACCAAGTGCCTCCCCCGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTTGTATCTCTGGAACGTG