ORFeome > ca12 ORF1 – XORFeome v1.0

ca12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ca12
Gene ID: 6255557
Gene Page ID: 1015245
ORF Xenbase ID: 17267355

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130102
Original XGC clone length: 1014

Human orthology & disease relationships

NCBI Entrez ID: 771
Ensembl gene IDs: ENSG00000074410
Directly associated (OMIM) disease MIM numbers: 143860
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ837631
dbEST ID: 79655333
Trimmed Sequence: ATGTATCTTCTGTTTCTTGCTCTCTTAGCTCTACCATCTGGCCAGGCAGCCTCTCCAGGTCACAGCTGGGGGTACTCTGGATCCAAAGGTGAGGAAAGCTGGCCAAAAAACTATGAATTCTGTGGTGGAGTCTATCAATCACCTGTTGATTTTCACCAAAATATCCTACAATATGATTCCACGCTGCAGCCTATTAAACTGAGTGGCTATAACGTGTCCTCTACAGACTCTTTCACACTGTCCAACAATGGACACACAGTACAAATGTCACTGGTTCCCACCATGAAAATAGAAATCGAGCCTTTTCACTATACTGCCTCCCAACTTCATTTGCACTGGGGACAAAAAAGCACTCCAAAAGGATCTGAACACTGCATTGAAGGCAAAAGATTTGCAGGAGAGGTGCATGTTGTCCACTACAATTCAGATAAGTACGCTGACCTCTCCACTGCCATGAAGGAATCGGATGGACTGGCAGTACTGGGAATTCTGATAGAGGTTGGCTCTTTCAATCCAACATTTGAAAAAATTATCTCTCAGATTCAAAATATCAGATTCAAAAACCAAAAAATTCAGATTGCAGGATTTGGTGTACGAGAACTTCTCCCTGAGAGACTTGATGAGTATTACCGTTACAAGGGCTCTCCAACAACCCCACCTTTGTACCCAATTGTGCCTGTGGACTGTCCTCCGGAAATCCCTGTGAATTAAACTGAAGGAACAACCTGAACCC
Full Trace Sequence: TCGAGGCACAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATCTTCTGTTTCTTGCTCTCTTAGCTCTACCATCTGGCCAGGCAGCCTCTCCAGGTCACAGCTGGGGGTACTCTGGATCCAAAGGTGAGGAAAGCTGGCCAAAAAACTATGAATTCTGTGGTGGAGTCTATCAATCACCTGTTGATTTTCACCAAAATATCCTACAATATGATTCCACGCTGCAGCCTATTAAACTGAGTGGCTATAACGTGTCCTCTACAGACTCTTTCACACTGTCCAACAATGGACACACAGTACAAATGTCACTGGTTCCCACCATGAAAATAGAAATCGAGCCTTTTCACTATACTGCCTCCCAACTTCATTTGCACTGGGGACAAAAAAGCACTCCAAAAGGATCTGAACACTGCATTGAAGGCAAAAGATTTGCAGGAGAGGTGCATGTTGTCCACTACAATTCAGATAAGTACGCTGACCTCTCCACTGCCATGAAGGAATCGGATGGACTGGCAGTACTGGGAATTCTGATAGAGGTTGGCTCTTTCAATCCAACATTTGAAAAAATTATCTCTCAGATTCAAAATATCAGATTCAAAAACCAAAAAATTCAGATTGCAGGATTTGGTGTACGAGAACTTCTCCCTGAGAGACTTGATGAGTATTACCGTTACAAGGGCTCTCCAACAACCCCACCTTTGTACCCAATTGTGCCTGTGGACTGTCCTCCGGAAATCCCTGTGAATTAAACTGAAGGAACAACCTGAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATCTTCTGTTTCTTGCTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837630
dbEST ID: 79655332
Trimmed Sequence: CACCTTGGAGGTGTTTTCTTCCACACCGGCAGCTACTGTGTATGCAACATTCCTGTTATCACTGGGCTTTCTGCTGCTTCTCTTTGTACGAATCAGCAAGCACGTAAATGCCATAATCACCAGTACTGCAAGCAAACAGGCTAATGCAATTGTGAGAACCAAACCTTCGCGAAAAGAGACAGACACCAGTCTCTCTCCATGTGACTGCAATTGTCTGTAGTTATTGGTCATCTCCACTGGTTCAGAGCTATTGCTATCAGTGCAGTATAAGGCAGTCTCCAGGGCGATCAGTTGCTCCTCAGATATAATCACAGGATTCCGGAAGACAGTCCACAGCACACTTGGGTAACAAGGTGGGGTTGTTAGAGAGCCCTCGTAACGGTAATACTCATCAAGTCTCTCAGGGAGAAGTTCTCGTACACCAAATCCTGCAATCTGAATTTTTTGGTTTTTGAATCTGATATTTTGAATCTGAGAGATAATTTTTTCTAATGTTGGATTGAAAGAGCCCACCTCTATCAAAATTCCCAGTACTGCCAGTCGATCGGATTCCTTCATGCAGTTGAGAGGTCAGCGTACTTATCTTAATTTGTAGTGGAGAACATGCACCTCCTCCGGCAAATCTTTTTCCCTTCAATGGCGTTGTCCAAAACCGTTTTTGAAGTGCCTTTGTTGTTCCCCCACTTCCCAATGGAAGTTTGGGAAGGGCAATTGTGGTTGGGAAAAGGCCTCCAATTTTCCGATTTTTTCATTGG
Full Trace Sequence: CGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCTTGGAGGTGTTTTCTTCCACACCGGCAGCTACTGTGTATGCAACATTCCTGTTATCACTGGGCTTTCTGCTGCTTCTCTTTGTACGAATCAGCAAGCACGTAAATGCCATAATCACCAGTACTGCAAGCAAACAGGCTAATGCAATTGTGAGAACCAAACCTTCGCGAAAAGAGACAGACACCAGTCTCTCTCCATGTGACTGCAATTGTCTGTAGTTATTGGTCATCTCCACTGGTTCAGAGCTATTGCTATCAGTGCAGTATAAGGCAGTCTCCAGGGCGATCAGTTGCTCCTCAGATATAATCACAGGATTCCGGAAGACAGTCCACAGCACACTTGGGTAACAAGGTGGGGTTGTTAGAGAGCCCTCGTAACGGTAATACTCATCAAGTCTCTCAGGGAGAAGTTCTCGTACACCAAATCCTGCAATCTGAATTTTTTGGTTTTTGAATCTGATATTTTGAATCTGAGAGATAATTTTTTCTAATGTTGGATTGAAAGAGCCCACCTCTATCAAAATTCCCAGTACTGCCAGTCGATCGGATTCCTTCATGCAGTTGAGAGGTCAGCGTACTTATCTTAATTTGTAGTGGAGAACATGCACCTCCTCCGGCAAATCTTTTTCCCTTCAATGGCGTTGTCCAAAACCGTTTTTGAAGTGCCTTTGTTGTTCCCCCACTTCCCAATGGAAGTTTGGGAAGGGCAATTGTGGTTGGGAAAAGGCCTCCAATTTTCCGATTTTTTCATTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTTGGAGGTGTTTTCTT