ORFeome > ca4 ORF1 – XORFeome v1.0

ca4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ca4
Gene ID: 6255799
Gene Page ID: 984031
ORF Xenbase ID: 17267373

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054242
Original XGC clone length: 939

Human orthology & disease relationships

NCBI Entrez ID: 762
Ensembl gene IDs: ENSG00000167434
Directly associated (OMIM) disease MIM numbers: 600852
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839503
dbEST ID: 79657205
Trimmed Sequence: ATGATGAAATGCTTCTCCCTCACTTTGCTTGTTAGCCTGTCATTTATCAAGAATTCAGCAGCAGCAGCAGCAGCAGCAGAAGGCCATTGGTGCTATGAAATCCAGGCATGTCAAGATCCAGGCTGTGGACCCAGGTTTTGGAACAACGCCAATACATTCTGCGGAGAAAAAGAGCAATCACCAATAAATATTCTCACCAAAAAAGCAGTTTTTATGGAATCCCTCAAAGAGTTTGACCTTAAAAGCTATGGTGTCAGTATACGGCAATTGAATGTTACAAATAATGGCCATTCTGCCCAAGTAGACCTGCCACCAGGTATTGAAATTTCAGGAGGTGGACTTTCAGGAACTTATGACGCAATACAGTTTCATTTCCATTGGGGCAGTGAAGAATTTCCTGGATCTGAACATACCATAGATGGTGAAAAATATCCAATGGAGCTTCACATAGTTCACAGAAGAAAAACTGCCAAAGCTGATACCGGTGGCACGGGCAGCAGGGATCTGGCTGTTCTTGGATTCTTTTATGAAGAAACTTCGACTAATAATACTGACTATGAACCACTAATTAATTCCTTAGAAGCCATTAGAACTAAAGGTGCAGTTAATAATTTCTCGGCTAACCTGACAAAACTGATTCCAGATAANGAAGAACTTAGAGTTTACTACAGGTAGCATGGGTCACTCACCACCCCTCCTGCAATGAGACTGTCACTTGGACTCTATTCAATACAACTATTAAACTGAATCAACAACAGCTTCGGAGCTTTCAATAAACAGCGAAAATTTTAAAAAAAACCCAAACCCAGGGGAGGAAAAAATTT
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGAAATGCTTCTCCCTCACTTTGCTTGTTAGCCTGTCATTTATCAAGAATTCAGCAGCAGCAGCAGCAGCAGCAGAAGGCCATTGGTGCTATGAAATCCAGGCATGTCAAGATCCAGGCTGTGGACCCAGGTTTTGGAACAACGCCAATACATTCTGCGGAGAAAAAGAGCAATCACCAATAAATATTCTCACCAAAAAAGCAGTTTTTATGGAATCCCTCAAAGAGTTTGACCTTAAAAGCTATGGTGTCAGTATACGGCAATTGAATGTTACAAATAATGGCCATTCTGCCCAAGTAGACCTGCCACCAGGTATTGAAATTTCAGGAGGTGGACTTTCAGGAACTTATGACGCAATACAGTTTCATTTCCATTGGGGCAGTGAAGAATTTCCTGGATCTGAACATACCATAGATGGTGAAAAATATCCAATGGAGCTTCACATAGTTCACAGAAGAAAAACTGCCAAAGCTGATACCGGTGGCACGGGCAGCAGGGATCTGGCTGTTCTTGGATTCTTTTATGAAGAAACTTCGACTAATAATACTGACTATGAACCACTAATTAATTCCTTAGAAGCCATTAGAACTAAAGGTGCAGTTAATAATTTCTCGGCTAACCTGACAAAACTGATTCCAGATAANGAAGAACTTAGAGTTTACTACAGGTAGCATGGGTCACTCACCACCCCTCCTGCAATGAGACTGTCACTTGGACTCTATTCAATACAACTATTAAACTGAATCAACAACAGCTTCGGAGCTTTCAATAAACAGCGAAAATTTTAAAAAAAACCCAAACCCAGGGGAGGAAAAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGAAATGCTTCTCCCTCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839502
dbEST ID: 79657204
Trimmed Sequence: TGACATTATTGTGAGGAGAGAAACTATAAAGCAGATGAACAAAGACCGGAAAGAGGACAAAATCGCTTGGCTGCTTGAAATGTAAACAGTCCTATCGCCCAGTCTCTGCACAGGCCGGAAATTTTCCACCATGCGTTGGTTTTCTGTAAAATTTAGGCTGTTATAGAAAGCCCGAAGCTGTTGTTGACTCAGTTTAATAGTTGTATTGAATAGAGTCCAAGTGACAGTCTCATTGCATGGAGGGGTGGTGAGTGACCCATTGTACCTGTAGTAAACTTTAAGTTCTTCCTTATCTGGAATCAGTTTTGTCAGGTTAGCCGAGAAATTTTTAACTGCACCTTTAGTTCTAATGGCTTCTAAGGAATTAATTAGTGGTTCATAGTCAGTATTATTAGTCGAAGTTTCTTCATAAAAGAATCCAAGAACAGCCAGATCCCTGCTGCCCGTGCCACCGGTATCAGCTTTGGCAGTTTTTCTTCTGTGAACTATGTGAAGCTCCATTGGATATTTTTCACCATCTATGGTATGTTCAGATCCAGGAAATTCTTCACTGCCCCAATGGAAATGAAACTGTATTGCGTCATAAGTTCCTGAAAGTCCACCTCCCGAAATTTCATACCTGGTGGGCAGGCTACTTGGGCAGAAAGGCCATTATTTGTACATTCAATTGCCCTATCCTGACCCCATACCTTTAAAAGTCAAACTTCTTTAAGGGATTCCAAAAAAACCGGCTTTTTTTTGGTAAAAAAAAATTAAATGGGT
Full Trace Sequence: CGGGTAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGACATTATTGTGAGGAGAGAAACTATAAAGCAGATGAACAAAGACCGGAAAGAGGACAAAATCGCTTGGCTGCTTGAAATGTAAACAGTCCTATCGCCCAGTCTCTGCACAGGCCGGAAATTTTCCACCATGCGTTGGTTTTCTGTAAAATTTAGGCTGTTATAGAAAGCCCGAAGCTGTTGTTGACTCAGTTTAATAGTTGTATTGAATAGAGTCCAAGTGACAGTCTCATTGCATGGAGGGGTGGTGAGTGACCCATTGTACCTGTAGTAAACTTTAAGTTCTTCCTTATCTGGAATCAGTTTTGTCAGGTTAGCCGAGAAATTTTTAACTGCACCTTTAGTTCTAATGGCTTCTAAGGAATTAATTAGTGGTTCATAGTCAGTATTATTAGTCGAAGTTTCTTCATAAAAGAATCCAAGAACAGCCAGATCCCTGCTGCCCGTGCCACCGGTATCAGCTTTGGCAGTTTTTCTTCTGTGAACTATGTGAAGCTCCATTGGATATTTTTCACCATCTATGGTATGTTCAGATCCAGGAAATTCTTCACTGCCCCAATGGAAATGAAACTGTATTGCGTCATAAGTTCCTGAAAGTCCACCTCCCGAAATTTCATACCTGGTGGGCAGGCTACTTGGGCAGAAAGGCCATTATTTGTACATTCAATTGCCCTATCCTGACCCCATACCTTTAAAAGTCAAACTTCTTTAAGGGATTCCAAAAAAACCGGCTTTTTTTTGGTAAAAAAAAATTAAATGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGACATTATTGTGAGGAGAGAAAC