ORFeome > cacng1 ORF1 – XORFeome v1.0

cacng1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cacng1
Gene ID: 997530
Gene Page ID: 997526
ORF Xenbase ID: 17267421

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129685
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ838686
dbEST ID: 79656388
Trimmed Sequence: ATGCAGGAGCTTAAGGCGCTTAAAATTAGGGTGACATCTTGTATCATCCTGGTGGGGATCTCGTTAATGTTAGCGGCTGTAATGAGCGACCACTGGGCAGTCCTCAGCCCCAAACTGGATGATGACACTCAGTCGTGTGAGGTGGCACATTTTGGCCTATGGAGGCTGTGTAAAAAGAAGATACTCATGGATGATCAGGAGACCATGCTCAAAGGATGTGGCCCACTGAGCCTTCCTGGGGAGCATAGCTGCACCTACTTCAAGCACTTCACTTCAGGAGAGAATGCGAACATATTCGAGGTGACGACACAGAAAGAGTACAGCATTTCGGCAGCTGCCATTGCCATTATCGGAGTTGGATTCATGACTATGGGCACAGTGTGCACCTTGTTGTCCTTCAAGGAGAAACTTGACTACCTGCTTAAACCCGCAGGTCTCTTCTTTATCTTTGCAGGACTGTGCATGATTATATCTGCGGAGGTGATCAGACAATCAGTGCATCGTATGATAGACAGTAAAGAGACAGTGTGGATCGAGTATTATTATTCCTGGTCCTTTGCTTGCGCCTGCTCAGCGCTTTTCGTGGTCTTCGTCTTCGGCATCGCCCTGGTGCTCATCTCCCTGGCACACAGGCCCAGGAACCCCTGGAAAAGCGGTAAGGATGCAAAACCCGATATATTGCGCAACTTTCTTTGTAAAAGTTTGGCATTATAAAAAAGAACAATTGCTTTATATAATTTTGTTTCAAACGAAAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGGAGCTTAAGGCGCTTAAAATTAGGGTGACATCTTGTATCATCCTGGTGGGGATCTCGTTAATGTTAGCGGCTGTAATGAGCGACCACTGGGCAGTCCTCAGCCCCAAACTGGATGATGACACTCAGTCGTGTGAGGTGGCACATTTTGGCCTATGGAGGCTGTGTAAAAAGAAGATACTCATGGATGATCAGGAGACCATGCTCAAAGGATGTGGCCCACTGAGCCTTCCTGGGGAGCATAGCTGCACCTACTTCAAGCACTTCACTTCAGGAGAGAATGCGAACATATTCGAGGTGACGACACAGAAAGAGTACAGCATTTCGGCAGCTGCCATTGCCATTATCGGAGTTGGATTCATGACTATGGGCACAGTGTGCACCTTGTTGTCCTTCAAGGAGAAACTTGACTACCTGCTTAAACCCGCAGGTCTCTTCTTTATCTTTGCAGGACTGTGCATGATTATATCTGCGGAGGTGATCAGACAATCAGTGCATCGTATGATAGACAGTAAAGAGACAGTGTGGATCGAGTATTATTATTCCTGGTCCTTTGCTTGCGCCTGCTCAGCGCTTTTCGTGGTCTTCGTCTTCGGCATCGCCCTGGTGCTCATCTCCCTGGCACACAGGCCCAGGAACCCCTGGAAAAGCGGTAAGGATGCAAAACCCGATATATTGCGCAACTTTCTTTGTAAAAGTTTGGCATTATAAAAAAGAACAATTGCTTTATATAATTTTGTTTCAAACGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGAGCTTAAGGCGCTTAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838685
dbEST ID: 79656387
Trimmed Sequence: CATATCGGGCTCTGCATCCATACAGCTTTCCCAGGGGTTCCTGGGCATGCGTGGCAGGGAGATGAGCACCAGGGCGATGCCGCAGATGAAGAGCACGACAAAGGCTGAGCAGGCGCAAGCAAAGGACCAGGAATAATAATACTCGATCCACACTGTCTCTTTACTGTCTATCATACGATGCACTGATTGTCTGATCACCTCCGCAGATATAATCATGCACAGTCCTGCAAAGATAAAGAAGAGACCTGCGGGTTTAAGCAGGTAGTCAAGTTTCTCCTTGAAGGACAACAAGGTGCACACTGTGCCCATAGTCATGAATCCAACTCCGATAATGGCAATGGCAGCTGCCGAAATGCTGTACTCTTTCTGTGTCGTCACCTCGAATATGTTCGCATTCTCTCCTGAAGTGAAGTGCTTGAAGTAGGTGCAGCTATGCTCCCCAGGAAGGCTCAGTGGGCCACATCCTTTGAGCATGGTCTCCTGATCATCCATGAGTATCTTCTTTTTACACAGCCTCCATAGGCCAAAATGTGCCACCTCACACAACTGAGTGTCATCATCCAATTTGGGGCGGAGGACTGCCCAGTGGTCGCTCATTACCGCCCGCTACGTAACCAAAATCTCCACAGGATGAAACGAGAAGTCCGCCTGAATTTAACCCCCTAAAGCTCCTGCATGGGGCCCGCTTTTGGTGTACAAATTGGCATTTGAAAAAAAAAAATGAACACATCGAGTTTTTTTTCCACCCCAAAAAAGAAAAAAA
Full Trace Sequence: GGAAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATATCGGGCTCTGCATCCATACAGCTTTCCCAGGGGTTCCTGGGCATGCGTGGCAGGGAGATGAGCACCAGGGCGATGCCGCAGATGAAGAGCACGACAAAGGCTGAGCAGGCGCAAGCAAAGGACCAGGAATAATAATACTCGATCCACACTGTCTCTTTACTGTCTATCATACGATGCACTGATTGTCTGATCACCTCCGCAGATATAATCATGCACAGTCCTGCAAAGATAAAGAAGAGACCTGCGGGTTTAAGCAGGTAGTCAAGTTTCTCCTTGAAGGACAACAAGGTGCACACTGTGCCCATAGTCATGAATCCAACTCCGATAATGGCAATGGCAGCTGCCGAAATGCTGTACTCTTTCTGTGTCGTCACCTCGAATATGTTCGCATTCTCTCCTGAAGTGAAGTGCTTGAAGTAGGTGCAGCTATGCTCCCCAGGAAGGCTCAGTGGGCCACATCCTTTGAGCATGGTCTCCTGATCATCCATGAGTATCTTCTTTTTACACAGCCTCCATAGGCCAAAATGTGCCACCTCACACAACTGAGTGTCATCATCCAATTTGGGGCGGAGGACTGCCCAGTGGTCGCTCATTACCGCCCGCTACGTAACCAAAATCTCCACAGGATGAAACGAGAAGTCCGCCTGAATTTAACCCCCTAAAGCTCCTGCATGGGGCCCGCTTTTGGTGTACAAATTGGCATTTGAAAAAAAAAAATGAACACATCGAGTTTTTTTTCCACCCCAAAAAAGAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATATCGGGCTCTGCATC