ORFeome > cacul1 ORF1 – XORFeome v1.0

cacul1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cacul1
Gene ID: 5896301
Gene Page ID: 5896293
ORF Xenbase ID: 17267433

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC127419
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ837473
dbEST ID: 79655175
Trimmed Sequence: ATGGAGGAGGAAGATGAGGAGAACATGGAGCAGGATCCCAACCACAACCACTGGCCCGAGCTGCCCAATCTCCCGGCCGCTTCCTCCGGGTACGGAACCTGCACCAAGCGCTGTGACAGCGGCCCCGGGAAAGCTCTGCTCGGTCTGACCGGTAACAGCACCTCCAAGTTCCTGATGAATGTGATTACGTTGGAGGATTACAGGACAACTTACTGGCCCAAACTAGACAGCGCCATAGAGCAGCTACTGACCCAGAGTCCCGGCGACTATATCCCTATATCCTACGAGCAAATCTACAGTTGTGTATATAAATGTGTGTGCCAGCAACACTCGGAGCAGATGTACAGTGACTTGATACATAAGATCACCAGCCACTTAGAGAGCGTCTCCCAGGAGCTACAGGCCAGTTCTCCTGCTGATTATATTGAGAAGTTTAACCTGGCTCTGGCTCAGTACATGGGAGCGCTGCACAGCATCGTCCCTCTTTTCATCTACATGAACAAGTTTTACATAGAAACCAAGCTAAACAGAGACCTAAAAGATGACTTAATACAGCTGTTTACCGACCATGTGGCAGAGGAGCACATTTATAGCCTGATGCCCTTATTACTAGAAGCCCAATCGACTCCTTTTCAAGTCACGCCGTCTACCATGGCAAGCATTTGTGAAAGCCTGTACACCCTGGAGGTCCGGATGGGGTCCAGCTGGCGGCCGACGCTCTTTTTTCAAGTTTATCCCCAACATTCCTGCCCCCCTGCCGGGGGGAGACCGAAAATACCAGGAACAACCCCTCCTTAAGGAACCCAAAAAATTTTACC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGGAAGATGAGGAGAACATGGAGCAGGATCCCAACCACAACCACTGGCCCGAGCTGCCCAATCTCCCGGCCGCTTCCTCCGGGTACGGAACCTGCACCAAGCGCTGTGACAGCGGCCCCGGGAAAGCTCTGCTCGGTCTGACCGGTAACAGCACCTCCAAGTTCCTGATGAATGTGATTACGTTGGAGGATTACAGGACAACTTACTGGCCCAAACTAGACAGCGCCATAGAGCAGCTACTGACCCAGAGTCCCGGCGACTATATCCCTATATCCTACGAGCAAATCTACAGTTGTGTATATAAATGTGTGTGCCAGCAACACTCGGAGCAGATGTACAGTGACTTGATACATAAGATCACCAGCCACTTAGAGAGCGTCTCCCAGGAGCTACAGGCCAGTTCTCCTGCTGATTATATTGAGAAGTTTAACCTGGCTCTGGCTCAGTACATGGGAGCGCTGCACAGCATCGTCCCTCTTTTCATCTACATGAACAAGTTTTACATAGAAACCAAGCTAAACAGAGACCTAAAAGATGACTTAATACAGCTGTTTACCGACCATGTGGCAGAGGAGCACATTTATAGCCTGATGCCCTTATTACTAGAAGCCCAATCGACTCCTTTTCAAGTCACGCCGTCTACCATGGCAAGCATTTGTGAAAGCCTGTACACCCTGGAGGTCCGGATGGGGTCCAGCTGGCGGCCGACGCTCTTTTTTCAAGTTTATCCCCAACATTCCTGCCCCCCTGCCGGGGGGAGACCGAAAATACCAGGAACAACCCCTCCTTAAGGAACCCAAAAAATTTTACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGGAAGATGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837472
dbEST ID: 79655174
Trimmed Sequence: TCTGTAGCTCTGGGTGCCAGCGCATGAGGAGGAGCCGTTGTATGTCAGTTCATCCCCTGCTCGCTTCCGTGACTGGTCCCCTCTGGTGAAGCCGTTCTGCGCCAGCTCCTGCTGTAACTTCTGGTCCTGAGCAGCGTAGTCTTGTAGTTCTGCTTCCACCGCAGGGGGCAGAATGTTGGGGATAAACTTTGAAAAGAGCGTCGGCGCCAGCTGGACCCATTCCGACCTCAGGGTGTACAGGCCTTTCACAATGCTTGCCATGGTAGACGGCGTGACTTGAAAAGGAGTCGATTGGGCTTCTAGTAATAAGGGCATCAGGCTATAAATGTGCTTTTCTGCCACATGGTCGGTAAACAGCTGTATTAAGTCATCTTTTAGGTCTCTGTTTAGCTTGGTTTCTATGTAAAACTTGTTCATGTAGATGAAAAGAGGGACGATGCTGTGCAGCGCTCCCATGTACTGAGCCAGAGCCACGTTAAACTTCTCAATATAATCAACAGGAGAACTGGCCTGTAGCTGCTGGGAGAGGCTCTCTAAGTGGCTGGTGATCGTATGTATCAAGTCACTGTACATCTGCTCCAACTGTTGCTGGGCGGGACGTTTATTTACACAACTGTAAATTTGCTCGTACGATATAAGAAGATAGTTCGCCGGGACGTGGGGGGGGGTTTCTGGTTCTTTGGCGGGGTTTAAATTTTTGCCCAATTAGGGGTGGGCCGGGGAATTCCTCCGGACGGAATTCCAAAATCCATTCCGGAAAACATTG
Full Trace Sequence: AAGCTGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGTAGCTCTGGGTGCCAGCGCATGAGGAGGAGCCGTTGTATGTCAGTTCATCCCCTGCTCGCTTCCGTGACTGGTCCCCTCTGGTGAAGCCGTTCTGCGCCAGCTCCTGCTGTAACTTCTGGTCCTGAGCAGCGTAGTCTTGTAGTTCTGCTTCCACCGCAGGGGGCAGAATGTTGGGGATAAACTTTGAAAAGAGCGTCGGCGCCAGCTGGACCCATTCCGACCTCAGGGTGTACAGGCCTTTCACAATGCTTGCCATGGTAGACGGCGTGACTTGAAAAGGAGTCGATTGGGCTTCTAGTAATAAGGGCATCAGGCTATAAATGTGCTTTTCTGCCACATGGTCGGTAAACAGCTGTATTAAGTCATCTTTTAGGTCTCTGTTTAGCTTGGTTTCTATGTAAAACTTGTTCATGTAGATGAAAAGAGGGACGATGCTGTGCAGCGCTCCCATGTACTGAGCCAGAGCCACGTTAAACTTCTCAATATAATCAACAGGAGAACTGGCCTGTAGCTGCTGGGAGAGGCTCTCTAAGTGGCTGGTGATCGTATGTATCAAGTCACTGTACATCTGCTCCAACTGTTGCTGGGCGGGACGTTTATTTACACAACTGTAAATTTGCTCGTACGATATAAGAAGATAGTTCGCCGGGACGTGGGGGGGGGTTTCTGGTTCTTTGGCGGGGTTTAAATTTTTGCCCAATTAGGGGTGGGCCGGGGAATTCCTCCGGACGGAATTCCAAAATCCATTCCGGAAAACATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGTAGCTCTGGGTGC