ORFeome > calcrl ORF1 – XORFeome v1.0

calcrl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: calcrl
Gene ID: 5736144
Gene Page ID: 5736125
ORF Xenbase ID: 17267475

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC044269
Original XGC clone length: 1431

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ824085
dbEST ID: 79641787
Trimmed Sequence: ATGGAAACATTGCAAATGGGACTCCTATCAAGATCAGCATTGTTCAAGTATATTATTATATTTCTAATCATGATTAACACAAGGGGTTATGTGTTGGCTTCACAAGAGCAAGAAGCAAAAACAAGTGTGCCTGAAGAGAGGCAAGTTGGTGTCACTCAAAATAAAATAATGACTGCACAGTATGAATGCTACCAAAAAATAATGCAGGAGCCGGCACATGGGAAAGAGGGACAGTTTTGTAACAGAACATGGGATGGCTGGTTATGTTGGGGTGATGTTGCTGCAGGAATAATATCTGAACAGCGGTGCCCTGATTATTTCCAGGACTTTGATCCTTCAGAAAAAGTAACAAAAGAATGTGGCAAAAATGGACACTGGTTCAGACATCCTGACAGCAACAGAACATGGACAAATTACACAAGGTGTAACACCTTCACACACGAAAAAGTAAAGACAGCCTTAAATCTGTACTATTTGACTATTATTGGACATGGACTATCCATTGCATCACTTTTGATTTCCTTGGGAATCTTCTTCTACTTTAAGAACTTGAGCTGCCAGAGAATTACACTTCATAAAAACTTATTTTTCTCCTTTGTTTGCAACTCTATTATTACAATAATTTTCTTTGTCAGCAGTGGCCAACAACCAAGCTTTAGTGGCAACCCATCCAGTCATCTGCAAAATATCCCAGTTTATCACCTGTATCTTGATGGGTGGTATTTATTTCTGGGGGGCGTTGGGGAAAAAAAAAATTTGCACCCTCTAAAATAATTATGGGCTGTTTTTTCCGAAAACAAAACTTTAAGGGGACAATTATTTAAAAAAAGGGGGGATTTCTTTTTTTTC
Full Trace Sequence: TAATGATTTTTATGTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAACATTGCAAATGGGACTCCTATCAAGATCAGCATTGTTCAAGTATATTATTATATTTCTAATCATGATTAACACAAGGGGTTATGTGTTGGCTTCACAAGAGCAAGAAGCAAAAACAAGTGTGCCTGAAGAGAGGCAAGTTGGTGTCACTCAAAATAAAATAATGACTGCACAGTATGAATGCTACCAAAAAATAATGCAGGAGCCGGCACATGGGAAAGAGGGACAGTTTTGTAACAGAACATGGGATGGCTGGTTATGTTGGGGTGATGTTGCTGCAGGAATAATATCTGAACAGCGGTGCCCTGATTATTTCCAGGACTTTGATCCTTCAGAAAAAGTAACAAAAGAATGTGGCAAAAATGGACACTGGTTCAGACATCCTGACAGCAACAGAACATGGACAAATTACACAAGGTGTAACACCTTCACACACGAAAAAGTAAAGACAGCCTTAAATCTGTACTATTTGACTATTATTGGACATGGACTATCCATTGCATCACTTTTGATTTCCTTGGGAATCTTCTTCTACTTTAAGAACTTGAGCTGCCAGAGAATTACACTTCATAAAAACTTATTTTTCTCCTTTGTTTGCAACTCTATTATTACAATAATTTTCTTTGTCAGCAGTGGCCAACAACCAAGCTTTAGTGGCAACCCATCCAGTCATCTGCAAAATATCCCAGTTTATCACCTGTATCTTGATGGGTGGTATTTATTTCTGGGGGGCGTTGGGGAAAAAAAAAATTTGCACCCTCTAAAATAATTATGGGCTGTTTTTTCCGAAAACAAAACTTTAAGGGGACAATTATTTAAAAAAAGGGGGGATTTCTTTTTTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACATTGCAAATGGGACT

Sequences - 3ʹ (reverse) EST

Accession: JZ829393
dbEST ID: 79647095
Trimmed Sequence: CATGTATTGTTTTTCTGTTTTAAAAAACACATTTTCCATATCATGGCAGTTTTTGCCATTTGAATGTTCACTGTAATCATGGGTATATGTCGTACCCTGGATCTCGCTGATTGAAGATACAGTATATGAAGCCGAGCGAAGGCCTTCTGAATGAGCAAAACTTCCAAACTGAATTCTGTATTGGTTCCAGTGTCTTTTTAGGACTGCTTGGACCTCTCCATTAAAAAAGCAGAAAATTGTAGCCACCAACAAACCCTGATAATGCATAAGGATGTGCATAACATAGTCATAGATTTCTTCTGCAATCCGCCCTTCAGGTTTCCAGGGGAACAGTACAAACTCAATTCCAAGAAGAGGGACAAGGATAAGCGTTGCTCTCACAGCTTTCATGTACAGGTTTGATTCTGCTTGATGTGTAACTTTGAGTTTTGTTATCAGAACACGTACAATGTTCAGAAGAAAGAACAGGTTTACCAACAGCGCAGCACAGATTGGTCCATGAATGATATACAGCAAGTGGGTTTCAGAACTAATCCAGCAGTTATCATTATAATATAAACTTCTGGCCACAGCGTGTATACATGCAGGAATCAATGGAAATCCCCATCCTAATAAATAGTACCACATTTAAATGTTGCTTTTCTCCAAAAACCACCCCTACCAATAGAAGTGGGCAAATAAATTTCCTTTCCCACAACCATCCCAAAAAAAATTTACCTCCCCAATCCAAAAAACAGGTGTGAAAAAAACCGGGGAAAAATTTTTTGCCAA
Full Trace Sequence: CTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTATTGTTTTTCTGTTTTAAAAAACACATTTTCCATATCATGGCAGTTTTTGCCATTTGAATGTTCACTGTAATCATGGGTATATGTCGTACCCTGGATCTCGCTGATTGAAGATACAGTATATGAAGCCGAGCGAAGGCCTTCTGAATGAGCAAAACTTCCAAACTGAATTCTGTATTGGTTCCAGTGTCTTTTTAGGACTGCTTGGACCTCTCCATTAAAAAAGCAGAAAATTGTAGCCACCAACAAACCCTGATAATGCATAAGGATGTGCATAACATAGTCATAGATTTCTTCTGCAATCCGCCCTTCAGGTTTCCAGGGGAACAGTACAAACTCAATTCCAAGAAGAGGGACAAGGATAAGCGTTGCTCTCACAGCTTTCATGTACAGGTTTGATTCTGCTTGATGTGTAACTTTGAGTTTTGTTATCAGAACACGTACAATGTTCAGAAGAAAGAACAGGTTTACCAACAGCGCAGCACAGATTGGTCCATGAATGATATACAGCAAGTGGGTTTCAGAACTAATCCAGCAGTTATCATTATAATATAAACTTCTGGCCACAGCGTGTATACATGCAGGAATCAATGGAAATCCCCATCCTAATAAATAGTACCACATTTAAATGTTGCTTTTCTCCAAAAACCACCCCTACCAATAGAAGTGGGCAAATAAATTTCCTTTCCCACAACCATCCCAAAAAAAATTTACCTCCCCAATCCAAAAAACAGGTGTGAAAAAAACCGGGGAAAAATTTTTTGCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTATTGTTTTTCTGTTTTAAA