ORFeome > calm2 ORF1 – XORFeome v1.0

calm2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: calm2
Gene ID: 1014645
Gene Page ID: 1014639
ORF Xenbase ID: 17267493

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054973
Original XGC clone length: 450

Human orthology & disease relationships

NCBI Entrez ID: 805
Ensembl gene IDs: ENSG00000143933,ENSG00000160014,ENSG00000198668
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,108500,117000,123500,125800,125853,137750,137760,141500,145600,151623,170400,183086,192600,192605,211980,232600,240600,253300,253400,253550,261750,275355,300071,300436,300558,300559,600334,600996,601005,601887,602579,603689,604145,604772,606003,606657,607200,608354,608355,608807,608808

Library Location

Plate ID: GDExl11003
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ839515
dbEST ID: 79657217
Trimmed Sequence: ATGGCTGACCAACTGACAGAAGAGCAGATTGCAGAGTTCAAAGAAGCATTCTCATTATTCGACAAGGATGGGGATGGTACCATCACCACAAAGGAACTTGGCACTGTTATGCGGTCGCTTGGACAAAACCCAACAGAAGCAGAATTGCAGGACATGATCAATGAAGTAGATGCTGATGGCAATGGAACAATTGACTTTCCTGAATTTCTGACTATGATGGCTAGAAAAATGAAAGACACAGACAGCGAAGAAGAAATCAGAGAAGCATTCCGTGTTTTTGACAAGGATGGCAATGGCTATATCAGTGCTGCTGAATTACGTCATGTGATGACAAACCTTGGGGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATAAGGGAAGCAGATATTGATGGAGATGGCCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTT
Full Trace Sequence: TCGTGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGACCAACTGACAGAAGAGCAGATTGCAGAGTTCAAAGAAGCATTCTCATTATTCGACAAGGATGGGGATGGTACCATCACCACAAAGGAACTTGGCACTGTTATGCGGTCGCTTGGACAAAACCCAACAGAAGCAGAATTGCAGGACATGATCAATGAAGTAGATGCTGATGGCAATGGAACAATTGACTTTCCTGAATTTCTGACTATGATGGCTAGAAAAATGAAAGACACAGACAGCGAAGAAGAAATCAGAGAAGCATTCCGTGTTTTTGACAAGGATGGCAATGGCTATATCAGTGCTGCTGAATTACGTCATGTGATGACAAACCTTGGGGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATAAGGGAAGCAGATATTGATGGAGATGGCCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGTCTTAGCTGAAAAACAAGAAAACACTGACCCGTGTCTCAAACCCCTGTGGAGGTTACAAAAGGGGGGTTTTGCCTGCTTCTGGTTCTCCCAAGTGGTGGGGGGGGTGTGTTTTTTGTTAGTGTGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAATCCAGGGGAGATATATTAAGGAGTTATATTATCGCCCGCCCCGGGCGGCGCTCAACCCCTCGCTCACCCCCGCGCTGTGGACTAGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGACCAACTGACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839514
dbEST ID: 79657216
Trimmed Sequence: CTTTGCTGTCATCATTTGTACAAACTCTTCATAGTTTACTTGGCCATCTCCATCAATATCTGCTTCCCTTATCATTTCATCAACTTCTTCATCTGTTAACTTCTCCCCAAGGTTTGTCATCACATGACGTAATTCAGCAGCACTGATATAGCCATTGCCATCCTTGTCAAAAACACGGAATGCTTCTCTGATTTCTTCTTCGCTGTCTGTGTCTTTCATTTTTCTAGCCATCATAGTCAGAAATTCAGGAAAGTCAATTGTTCCATTGCCATCAGCATCTACTTCATTGATCATGTCCTGCAATTCTGCTTCTGTTGGGTTTTGTCCAAGCGACCGCATAACAGTGCCAAGTTCCTTTGTGGTGATGGTACCATCCCCATCCTTGTCGAATAATGAGAATGCTTCTTTGAACTCTGCAATCTGCTCTTCTGTCAGTTGGTCAGCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGCTGTCATCATTTGTACAAACTCTTCATAGTTTACTTGGCCATCTCCATCAATATCTGCTTCCCTTATCATTTCATCAACTTCTTCATCTGTTAACTTCTCCCCAAGGTTTGTCATCACATGACGTAATTCAGCAGCACTGATATAGCCATTGCCATCCTTGTCAAAAACACGGAATGCTTCTCTGATTTCTTCTTCGCTGTCTGTGTCTTTCATTTTTCTAGCCATCATAGTCAGAAATTCAGGAAAGTCAATTGTTCCATTGCCATCAGCATCTACTTCATTGATCATGTCCTGCAATTCTGCTTCTGTTGGGTTTTGTCCAAGCGACCGCATAACAGTGCCAAGTTCCTTTGTGGTGATGGTACCATCCCCATCCTTGTCGAATAATGAGAATGCTTCTTTGAACTCTGCAATCTGCTCTTCTGTCAGTTGGTCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGAAAACAAAAACATAAAACAGACCATCATTGTACACAAACATGAACTGGGAAGAAAAGAAAAAATACGTCCATCCAAAAATGGGGGCGGAGATTTCACTTGTTTTGGATGGGGACGCAACACAAAAAAAAAAAAAACTACGAGCTACAAAAATAATGGAATGAGGGAAGGGGGCGCGGCGCCGGGGGCGCAACCCTGNANAAAAAAGAAGAGGGGGGGAAGGGGGGGGNGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGCTGTCATCATTTGTACAAA