ORFeome > calr ORF1 – XORFeome v1.0

calr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: calr
Gene ID: 1018219
Gene Page ID: 1018212
ORF Xenbase ID: 17267499

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044068
Original XGC clone length: 1257

Human orthology & disease relationships

NCBI Entrez ID: 811
Ensembl gene IDs: ENSG00000179218
Directly associated (OMIM) disease MIM numbers: 187950,254450
Indirectly associated (Lage, et al.) disease MIM numbers: 105200,121850,137800,144010,153480,158350,176807,176920,205400,276950,300555,309000,604091,608089

Library Location

Plate ID: GDExl11008
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ823611
dbEST ID: 79641313
Trimmed Sequence: ATGGCGCGCGCTGCCCTTCTCGTCCTGCCGCTCCTCGCGGCTCTGTGCATCGCAGAACCCGCCGTCTACTTCAAGGAAGAGTTCACTGACGGAGATGGCTGGACGCAGCGCTGGGTAGAATCAAAGCACAAAACTGACTATGGAAAGTTCAAGTTAAGTGCCGGGAAGTTCTACGGAGACTCCGAGAAGGACAAAGGTCTCCAGACAAGCCAGGACGCCCGCTTCTATGCCATGTCTTCTCGCTTTGACTCCTTCTCCAACAAAGATCAGACCCTGGTCGTTCAGTTTTCAGTGAAGCACGAGCAGAACATCGACTGTGGCGGTGGATACGTGAAGCTTTTCCCTGCAGCCCTGGAACAGACTGAAATGCACGGAGAATCCGAGTACAACATCATGTTCGGCCCTGACATCTGCGGCCCCCCCACAAAGAAGGTGCATGTTATCTTCCAGTACAAGAAGAAGAACCTTCAGATCAACAAGGATATCCGCTGCAAGGATGATTCTTTCACCCACTTGTACACCTTGATTGTGCGGCCAGACAACACGTATGAAGTGAAGATCGACAACAGCAAGGTGGAATCTGGCAGCCTGGAAGATGACTGGGATTTCCTGCCCCCCAAGAAGATTAAGGACCCCGAGGCCCAGAAGCCGGATGAGTGGGACGAGCGCCCCAAGATCGATGACCCA
Full Trace Sequence: CCAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCGCGCTGCCCTTCTCGTCCTGCCGCTCCTCGCGGCTCTGTGCATCGCAGAACCCGCCGTCTACTTCAAGGAAGAGTTCACTGACGGAGATGGCTGGACGCAGCGCTGGGTAGAATCAAAGCACAAAACTGACTATGGAAAGTTCAAGTTAAGTGCCGGGAAGTTCTACGGAGACTCCGAGAAGGACAAAGGTCTCCAGACAAGCCAGGACGCCCGCTTCTATGCCATGTCTTCTCGCTTTGACTCCTTCTCCAACAAAGATCAGACCCTGGTCGTTCAGTTTTCAGTGAAGCACGAGCAGAACATCGACTGTGGCGGTGGATACGTGAAGCTTTTCCCTGCAGCCCTGGAACAGACTGAAATGCACGGAGAATCCGAGTACAACATCATGTTCGGCCCTGACATCTGCGGCCCCCCCACAAAGAAGGTGCATGTTATCTTCCAGTACAAGAAGAAGAACCTTCAGATCAACAAGGATATCCGCTGCAAGGATGATTCTTTCACCCACTTGTACACCTTGATTGTGCGGCCAGACAACACGTATGAAGTGAAGATCGACAACAGCAAGGTGGAATCTGGCAGCCTGGAAGATGACTGGGATTTCCTGCCCCCCAAGAAGATTAAGGACCCCGAGGCCCAGAAGCCGGATGAGTGGGACGAGCGCCCCAAGATCGATGACCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCGCGCTGCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ828910
dbEST ID: 79646612
Trimmed Sequence: AAGCTCATCTTTAAGAGGTGTTTCTTCTTCATCTTCCTCCTCTTCTTCTTCTTCCTTCTCTTCCTCTTTTTCCTCCTCATCATCATCGTCCTCATCTTCCTCTTCCTGTGGCTCTTCCTCCTTCCTCGTCTTCTCTTCTTCTTCCTGTTTCTTGCGATCCTCCTCATCCTGCTGTTCCTTCATTTTCTTTTCTGCTTCCTTTGTAACCCCCCAGGTTTCGTTTCCATATTCTTCTGCATGTTTCTCATCGTTGGTCATCAGGAAGTTGTCAAAAATGGTGCCAGATTTCACCTGCCACAAGTCCAGGCCGAGCACTCCGAAGCTGTCATAGCTGTACAGAGTATCATCAGGGGTGTATTCTGGGTTATCAATCTCTGGATGGATCCACTTTCCTTTGTAATCTGGGTTATCAATCTGACGGGGTTTCCATTCTCCCTTGTACTCTGGGTTCTGTATAACAGGGGGCTCCCACTCGCCATCCATCTCCTCATCCCAGTCTTCAGGCTTCACAGCATCGGGGTCTGGAATGTGTTCAGGTTTTTCCCAATCCTCTGGCTTTTTGTCTTCTGGGTCATCGATCTTGGGGCGCTCGTCCCACTCATCCGGCTTCTTGGCCTCGGGGTCCTTAATCTTCTTGGGGGGC
Full Trace Sequence: GCTGCCGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGCTCATCTTTAAGAGGTGTTTCTTCTTCATCTTCCTCCTCTTCTTCTTCTTCCTTCTCTTCCTCTTTTTCCTCCTCATCATCATCGTCCTCATCTTCCTCTTCCTGTGGCTCTTCCTCCTTCCTCGTCTTCTCTTCTTCTTCCTGTTTCTTGCGATCCTCCTCATCCTGCTGTTCCTTCATTTTCTTTTCTGCTTCCTTTGTAACCCCCCAGGTTTCGTTTCCATATTCTTCTGCATGTTTCTCATCGTTGGTCATCAGGAAGTTGTCAAAAATGGTGCCAGATTTCACCTGCCACAAGTCCAGGCCGAGCACTCCGAAGCTGTCATAGCTGTACAGAGTATCATCAGGGGTGTATTCTGGGTTATCAATCTCTGGATGGATCCACTTTCCTTTGTAATCTGGGTTATCAATCTGACGGGGTTTCCATTCTCCCTTGTACTCTGGGTTCTGTATAACAGGGGGCTCCCACTCGCCATCCATCTCCTCATCCCAGTCTTCAGGCTTCACAGCATCGGGGTCTGGAATGTGTTCAGGTTTTTCCCAATCCTCTGGCTTTTTGTCTTCTGGGTCATCGATCTTGGGGCGCTCGTCCCACTCATCCGGCTTCTTGGCCTCGGGGTCCTTAATCTTCTTGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCTCATCTTTAAGAGGTGTTTC