ORFeome > canx ORF1 – XORFeome v1.0

canx ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: canx
Gene ID: 6251650
Gene Page ID: 5735139
ORF Xenbase ID: 17267583

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041719
Original XGC clone length: 1845

Human orthology & disease relationships

NCBI Entrez ID: 821
Ensembl gene IDs: ENSG00000127022
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 162800,176410,188050,219700,233300,236250,241200,260500,266120,277180,600155,600501,603813,605899,608115,609560

Library Location

Plate ID: GDExl11008
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ823578
dbEST ID: 79641280
Trimmed Sequence: ATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCACGACCGTGACCACGATCATCATGACCACGATCATGACCATCATGACCACGATCATGACCACGACCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGAACTTAAATC
Full Trace Sequence: TAATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCACGACCGTGACCACGATCATCATGACCACGATCATGACCATCATGACCACGATCATGACCACGACCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGAACTTAAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCTGAAATGGTTTCTGTTA

Sequences - 3ʹ (reverse) EST

Accession: JZ828876
dbEST ID: 79646578
Trimmed Sequence: ATCTTTTCGAGGTTTTCGATTTCTTGGAGATCTGTTCATAATGTCGTCTTCTTTAGGTTTGATCTCCTCTTCTGCCTCCTCTTCCTCTTGGCTTTCTTGCCCTTCATCACCTTCATCTTCATCCTGCTTTGGTTTTTGCGTGTCACTTTCTTCAGCATCTTCTTCCTCTTCAGCCTTATTGTCTTTTTCTTCTTCTTCCTCCTCCTCCTCCTCTTTTACATCAGGCTGGGGAGCATCAGTCTTTTTGTGTTCTGCATCCAATGGCTTTCCAGAGCAGCAGAAGAGTATAACCAGAAAAACTGGCAGAGCCACAGTCAGAATATAAACAATCCAGAGCCAAGGTCTTTCCTCTGCAGCAGTTATCATTTGTCCCACTACACTAGGCGCAGAAGCTCCATCAGCTGCCTTTTTTAGGCCCCATCCATCATTAGCCCAGTCATCAGCCACATTTCTCTCTGAGCAGATAATAAAATTATCAAAGAAAATATCGGAAGTCATAGACCACAGTTCAAGGCCAACTGCGTAGAATGGAGTCATTCTGAATGGTTCTAGATCTTCAAAGAAATCTGGATTTGGGATTTTTCTTGGTTTTCATATACCCTGATAGTCTGGATTATCAATCATTGGGAGACTTCCAATTTGCCCTTGTACATGGGATTGTCCATAATTAG
Full Trace Sequence: TGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTTTTCGAGGTTTTCGATTTCTTGGAGATCTGTTCATAATGTCGTCTTCTTTAGGTTTGATCTCCTCTTCTGCCTCCTCTTCCTCTTGGCTTTCTTGCCCTTCATCACCTTCATCTTCATCCTGCTTTGGTTTTTGCGTGTCACTTTCTTCAGCATCTTCTTCCTCTTCAGCCTTATTGTCTTTTTCTTCTTCTTCCTCCTCCTCCTCCTCTTTTACATCAGGCTGGGGAGCATCAGTCTTTTTGTGTTCTGCATCCAATGGCTTTCCAGAGCAGCAGAAGAGTATAACCAGAAAAACTGGCAGAGCCACAGTCAGAATATAAACAATCCAGAGCCAAGGTCTTTCCTCTGCAGCAGTTATCATTTGTCCCACTACACTAGGCGCAGAAGCTCCATCAGCTGCCTTTTTTAGGCCCCATCCATCATTAGCCCAGTCATCAGCCACATTTCTCTCTGAGCAGATAATAAAATTATCAAAGAAAATATCGGAAGTCATAGACCACAGTTCAAGGCCAACTGCGTAGAATGGAGTCATTCTGAATGGTTCTAGATCTTCAAAGAAATCTGGATTTGGGATTTTTCTTGGTTTTCATATACCCTGATAGTCTGGATTATCAATCATTGGGAGACTTCCAATTTGCCCTTGTACATGGGATTGTCCATAATTAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTTTCGAGGTTTTCGATTTCT