ORFeome > capn1 ORF1 – XORFeome v1.0

capn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: capn1
Gene ID: 6540652
Gene Page ID: 990195
ORF Xenbase ID: 17267601

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044317
Original XGC clone length: 2142

Human orthology & disease relationships

NCBI Entrez ID: 823
Ensembl gene IDs: ENSG00000014216
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 166200,166220,231200

Library Location

Plate ID: GDExl11007
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ823535
dbEST ID: 79641237
Trimmed Sequence: ATGGCTGAAGAAGTGATCGTGCCAGTTTATGCCACTGGGATTTCGGCGCAGCTGCAGAAGCAACGTGATCAAGATCTGGGTGTAGGGAAACATGAGAATGCAGTCAAATTTCTGGGACAGGATTATGACAGGATTCGCCACGAGTGCCTGCAAAACGGAACCCTCTTTAAGGACGACACATTCCCAGCCTCTGCTTACTCTCTGGGTTTTAAGGAGCTCGGCCCAAACTCATCCAAAACCTATGGTGTAAAATGGGTTCGGCCTTCGCAACTCGTCTCCAACCCACAGTTTATTGTCGATGGTGCCACAAGAACAGACATCTGTCAGGGAGCATTGGGTGACTGTTGGCTCCTCGCTGCTATCGCCTCCCTCACATTAAACGAAACAGTCCTGCACCGTGTAGTACCTCATGGCCAGAGCTTCCAGGAGAACTATGCTGGCGTCTTTCATTTTCAGCTGTGGCAGTTTGGCGAGTGGGTCGATGTGGTTATCGATGATTTGCTCCCTGTTAAAGATGGAAAACTTGTGTTCGTGCACTCGGCTTCTGGGAATGAGTTCTGGAGTGCTTTGCTGGAGAAGGCCTATGCCAAGGCCAACGGTTGTTATGAGGCTCTTTCTGGAGGCAGCACATCAGAAGGTTTTGAGGATTTTACTGGAGGTGTTACTGAGTGGTATGAGATGAAAGAAGCACCCACAGATCTGTTTAACATTATTCTGAAGGCACTGGAGCGAGGTTCCCTCATGGGGCTGGTCCATTGA
Full Trace Sequence: GCATTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAGAAGTGATCGTGCCAGTTTATGCCACTGGGATTTCGGCGCAGCTGCAGAAGCAACGTGATCAAGATCTGGGTGTAGGGAAACATGAGAATGCAGTCAAATTTCTGGGACAGGATTATGACAGGATTCGCCACGAGTGCCTGCAAAACGGAACCCTCTTTAAGGACGACACATTCCCAGCCTCTGCTTACTCTCTGGGTTTTAAGGAGCTCGGCCCAAACTCATCCAAAACCTATGGTGTAAAATGGGTTCGGCCTTCGCAACTCGTCTCCAACCCACAGTTTATTGTCGATGGTGCCACAAGAACAGACATCTGTCAGGGAGCATTGGGTGACTGTTGGCTCCTCGCTGCTATCGCCTCCCTCACATTAAACGAAACAGTCCTGCACCGTGTAGTACCTCATGGCCAGAGCTTCCAGGAGAACTATGCTGGCGTCTTTCATTTTCAGCTGTGGCAGTTTGGCGAGTGGGTCGATGTGGTTATCGATGATTTGCTCCCTGTTAAAGATGGAAAACTTGTGTTCGTGCACTCGGCTTCTGGGAATGAGTTCTGGAGTGCTTTGCTGGAGAAGGCCTATGCCAAGGCCAACGGTTGTTATGAGGCTCTTTCTGGAGGCAGCACATCAGAAGGTTTTGAGGATTTTACTGGAGGTGTTACTGAGTGGTATGAGATGAAAGAAGCACCCACAGATCTGTTTAACATTATTCTGAAGGCACTGGAGCGAGGTTCCCTCATGGGGCTGGTCCATTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAGAAGTGATCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828834
dbEST ID: 79646536
Trimmed Sequence: TGCAAACATTGTCATTTGGAGCCAACTAAACAGGTCAAAATTGATCACTCCTTGTTTCTGTGTGTCCATACCCTGGAAAAATCGGAACATAGTCTCCAGCCTGATGAGACAGCATGTGAAGCTATCGAAATTCACGGCCATATCAGGCTCCGAGTATCTGGTGATGATGAGCTGGTGCAGACTGTTGGTCAACTTGAAACCTGCAGACTCCAAAGCTAGACGCATCTCATATGCGCTCATGCTTCCAGATTTATCCATGTCAAACTTTCGGAATATGGTCAAGTAATTCTTAATTTTATTCCACAGAATATTGAACTCCACCAGTCCTAATTTCCCATTTCCATCTTTATCCATCAGGTTCACCATGCTGCGGCACGACTCCAAACTAAATCCCGTTGTGCGGAGATCTTTATGTTTTGATACAATTTTATTTAAAATGGACTGTAACTCCGTATAACTGATTTCCATATCAGCACCAGCTAGCTGCTTGAAAAGGTTCTTGAACCCTTGATCGATTTCAGTCTCTGACAGAACTTCCTCAGGAGGTAGGTCAGCAGATAAAGGATCATCCATCTCAACAGAGCCATGCTTGTTTTCAGAGAAGACTCTAATGACAAAGTCTCCTTCCACATTAGGTTCAAAGGTAGAAAGCACCACAATG
Full Trace Sequence: GGGCTGCCCGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAAACATTGTCATTTGGAGCCAACTAAACAGGTCAAAATTGATCACTCCTTGTTTCTGTGTGTCCATACCCTGGAAAAATCGGAACATAGTCTCCAGCCTGATGAGACAGCATGTGAAGCTATCGAAATTCACGGCCATATCAGGCTCCGAGTATCTGGTGATGATGAGCTGGTGCAGACTGTTGGTCAACTTGAAACCTGCAGACTCCAAAGCTAGACGCATCTCATATGCGCTCATGCTTCCAGATTTATCCATGTCAAACTTTCGGAATATGGTCAAGTAATTCTTAATTTTATTCCACAGAATATTGAACTCCACCAGTCCTAATTTCCCATTTCCATCTTTATCCATCAGGTTCACCATGCTGCGGCACGACTCCAAACTAAATCCCGTTGTGCGGAGATCTTTATGTTTTGATACAATTTTATTTAAAATGGACTGTAACTCCGTATAACTGATTTCCATATCAGCACCAGCTAGCTGCTTGAAAAGGTTCTTGAACCCTTGATCGATTTCAGTCTCTGACAGAACTTCCTCAGGAGGTAGGTCAGCAGATAAAGGATCATCCATCTCAACAGAGCCATGCTTGTTTTCAGAGAAGACTCTAATGACAAAGTCTCCTTCCACATTAGGTTCAAAGGTAGAAAGCACCACAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAAACATTGTCATTTGGAGC