ORFeome > capn3 ORF1 – XORFeome v1.0

capn3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: capn3
Gene ID: 5875757
Gene Page ID: 5875738
ORF Xenbase ID: 17267619

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123364
Original XGC clone length: 921

Human orthology & disease relationships

NCBI Entrez ID: 825
Ensembl gene IDs: ENSG00000092529
Directly associated (OMIM) disease MIM numbers: 253600
Indirectly associated (Lage, et al.) disease MIM numbers: 222900,232300,241500,241510,253600

Library Location

Plate ID: GDExl11084
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ837530
dbEST ID: 79655232
Trimmed Sequence: ATGCATGGCAACAATCAGCACCTGGCAAAGGATTTCTTCCTCTACAATGCCTCCAAAGCCAAGTGTAAAACCTACATCAACATGAAGAGAAGTCTGCCAGCGTTTCCGATTGCCCCCAAGTGAATATGTCATTATCCCCTCTACCTACGAGCCCCACCAGGAAGGAGAGTTCATTTTAAGGGTTTTCTCTGAGAAAAGAAATATTTCGGAAGAAGTTGAATACAAGATCGAAGCAGAAAAAACAATTAAAAAGAAAAAGAAAGCCAAGCCTATCATCTTTGTGTCGGACAGATCAAACAGCAATAAAGAGTTGACCGTGGATGGCGCCACTGATGAAGACCAGAAAAAATTGAACGCAGATCAAAAAGATAAGACCTCCGTTAGTACAGACACAGAGACCGAGGAAGAAAAGCAGTTTAGGAATATCTTCCAACAGATCGCAGGGGATGACATGGAAATTAGTGCTGATGAGCTTCAAAGTGTCCTGAACAATGTAGTTAACAAACATAAAACCCTGAAATCCAATGGATTCAGCCTAGAGTCATGCCGCAGCATGATTGCGCTTATGGATACTGATGGCTGCGGGAGGCTCAACCTGCAAGAATTCTTTCACCTCTGGCAAAAGATCAAACAGTGGCAGAAAATCCTCTTGCGTTTGGATTCTTGACCATTCGGGGAACATCAGTAACTTTTGAGATGCAAAATGCCGTCCAATGGAGGCTGGGTTTTCGTTCGAAACATTCACCTGGTATGAAATTTAATAAAAAAGCGTTTAACCCAAATAAAAAAAATTGAAAAATTGAACTTTTAAACATTTTTTCACTT
Full Trace Sequence: GAGGGCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATGGCAACAATCAGCACCTGGCAAAGGATTTCTTCCTCTACAATGCCTCCAAAGCCAAGTGTAAAACCTACATCAACATGAAGAGAAGTCTGCCAGCGTTTCCGATTGCCCCCAAGTGAATATGTCATTATCCCCTCTACCTACGAGCCCCACCAGGAAGGAGAGTTCATTTTAAGGGTTTTCTCTGAGAAAAGAAATATTTCGGAAGAAGTTGAATACAAGATCGAAGCAGAAAAAACAATTAAAAAGAAAAAGAAAGCCAAGCCTATCATCTTTGTGTCGGACAGATCAAACAGCAATAAAGAGTTGACCGTGGATGGCGCCACTGATGAAGACCAGAAAAAATTGAACGCAGATCAAAAAGATAAGACCTCCGTTAGTACAGACACAGAGACCGAGGAAGAAAAGCAGTTTAGGAATATCTTCCAACAGATCGCAGGGGATGACATGGAAATTAGTGCTGATGAGCTTCAAAGTGTCCTGAACAATGTAGTTAACAAACATAAAACCCTGAAATCCAATGGATTCAGCCTAGAGTCATGCCGCAGCATGATTGCGCTTATGGATACTGATGGCTGCGGGAGGCTCAACCTGCAAGAATTCTTTCACCTCTGGCAAAAGATCAAACAGTGGCAGAAAATCCTCTTGCGTTTGGATTCTTGACCATTCGGGGAACATCAGTAACTTTTGAGATGCAAAATGCCGTCCAATGGAGGCTGGGTTTTCGTTCGAAACATTCACCTGGTATGAAATTTAATAAAAAAGCGTTTAACCCAAATAAAAAAAATTGAAAAATTGAACTTTTAAACATTTTTTCACTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATGGCAACAATCAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837529
dbEST ID: 79655231
Trimmed Sequence: AGCATACACGGTAAGCTGCAGCCACTCCAGCACATTCAGCTTAATGATACCATCTCCATCTTTGTCAAACGCATGGAATGCCCTGAACATTCCTTCCAGGCGCACAAAGCAGCAGATGAAACTGTCAAAGTCAATGTCCATTCTCTTATTGGCATAACGCATTGTGATAATGTCATACAGCTGACTGTTCAGACGGAAACCAGCTTCATTGACGGCATTTCGCATCTCAAAGCTACTGATGGTCCCCGACTGGTCAGAATCAAAACGCAAGAAGATTTTCTGCCACTGTTTGATCTTTTGCCAGAGGTGAAAGAATTCTTGCAGGTTGAGCCTCCCGCAGCCATCAGTATCCATAAGCGCAATCATGCTGCGGCATGACTCTAGGCTGAATCCATTGGATTTCAGGGTTTTATGTTTGTTAACTACATTGTTCAGGACACTTTGAAGCTCATCAGCACTAATTTCCATGTCATCCCCTGCGATCTGTTGGAAGATATTCCTAAACTGCTTTTCTTCCTCGGTCTCTGTGTCTGTACTAACGGAGGTCTTATCTTTTTGATCTGCGTTCAATTTTTTCTGGTCTTCATCGGTGGCGCCATCCGCGGTCGACTCCTTAATTGCTGTTTGATCTGTCCGAAACAAAAAAGAAAAGGCTGGGCCTTTGTTTTCCTTTTTAATTTTTTTTTTCCGGCGTCGAATCTTTGAAGGCAACTTCCTTGCGAAATATTTTCTTTTTCTCAAAAAAAAAACCCTATAAAAATAAAACACCT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCATACACGGTAAGCTGCAGCCACTCCAGCACATTCAGCTTAATGATACCATCTCCATCTTTGTCAAACGCATGGAATGCCCTGAACATTCCTTCCAGGCGCACAAAGCAGCAGATGAAACTGTCAAAGTCAATGTCCATTCTCTTATTGGCATAACGCATTGTGATAATGTCATACAGCTGACTGTTCAGACGGAAACCAGCTTCATTGACGGCATTTCGCATCTCAAAGCTACTGATGGTCCCCGACTGGTCAGAATCAAAACGCAAGAAGATTTTCTGCCACTGTTTGATCTTTTGCCAGAGGTGAAAGAATTCTTGCAGGTTGAGCCTCCCGCAGCCATCAGTATCCATAAGCGCAATCATGCTGCGGCATGACTCTAGGCTGAATCCATTGGATTTCAGGGTTTTATGTTTGTTAACTACATTGTTCAGGACACTTTGAAGCTCATCAGCACTAATTTCCATGTCATCCCCTGCGATCTGTTGGAAGATATTCCTAAACTGCTTTTCTTCCTCGGTCTCTGTGTCTGTACTAACGGAGGTCTTATCTTTTTGATCTGCGTTCAATTTTTTCTGGTCTTCATCGGTGGCGCCATCCGCGGTCGACTCCTTAATTGCTGTTTGATCTGTCCGAAACAAAAAAGAAAAGGCTGGGCCTTTGTTTTCCTTTTTAATTTTTTTTTTCCGGCGTCGAATCTTTGAAGGCAACTTCCTTGCGAAATATTTTCTTTTTCTCAAAAAAAAAACCCTATAAAAATAAAACACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCATACACGGTAAGCTG