ORFeome > capza1 ORF1 – XORFeome v1.0

capza1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: capza1
Gene ID: 865890
Gene Page ID: 489685
ORF Xenbase ID: 17267673

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060481
Original XGC clone length: 840

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11022
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ824858
dbEST ID: 79642560
Trimmed Sequence: ATGGCTGATTACGAAGATCGGGTGTCTGATGAAGAGAAGGTGCGCATTGCAGCAAAGTTCATAACCCATGCCCCCCCAGGAGAATTCAATGAGGTCTTTAATGATGTCCGGCTTTTACTCAACAATGACAACCTGCTCAGGGAAGGAGCAGCGCATGCCTTTGCCCAATATAACATGGATCAGTTTACACCTGCTAAGATTGAAGGCTATGATGACCAGGTCCTTATAACAGAGCATGGAGATCTTGGCAATAGCAGATTTCTGGATCCACGGAATCGAATTACCTTTAAGTTTGATCACTTAAGGAAAGAAGCTAGTGATCCTCATCCTGACGACAGTGATGTGGCTTTAAAATCCTGGAGAGATGCTTGTGACTTGGCCTTGCGGGCATATGTGAAAGAACACTATCCGAATGGTGTCTGCACTGTTTATGGAAAGACAATAGATGGACAGCAAACAATAGTATCTTGTATTGAAAGCCACCAGTTTCAGCCTAAGAACTTTTGGAATGGTCGCTGGAGGTCTGAATGGAAATTTACCATCTCGGGATCCACTGCTCAGTTGGTTCATTACTATGAGGATGGAAATGTTCAGTTAGTTAGCCACAAAGATGTGCAGGATCCATAACAATCTCTGGTGAAGCTCAAACCGCCNAGGAATTTGTAAAATTATAGAGCAAGCAGAGAGTGACTACCAGACTGCCATAAGCGAGACTATCAGAACATGTCAGACACAACTTTCAAAGCCTATCGCGGGCGGCTGCCCGTGACCCCCACCAGGACGACGGGGATAAAAAATCCAGCTACAAAATTGGGCAAAAAAAGCAA
Full Trace Sequence: CAATATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGATTACGAAGATCGGGTGTCTGATGAAGAGAAGGTGCGCATTGCAGCAAAGTTCATAACCCATGCCCCCCCAGGAGAATTCAATGAGGTCTTTAATGATGTCCGGCTTTTACTCAACAATGACAACCTGCTCAGGGAAGGAGCAGCGCATGCCTTTGCCCAATATAACATGGATCAGTTTACACCTGCTAAGATTGAAGGCTATGATGACCAGGTCCTTATAACAGAGCATGGAGATCTTGGCAATAGCAGATTTCTGGATCCACGGAATCGAATTACCTTTAAGTTTGATCACTTAAGGAAAGAAGCTAGTGATCCTCATCCTGACGACAGTGATGTGGCTTTAAAATCCTGGAGAGATGCTTGTGACTTGGCCTTGCGGGCATATGTGAAAGAACACTATCCGAATGGTGTCTGCACTGTTTATGGAAAGACAATAGATGGACAGCAAACAATAGTATCTTGTATTGAAAGCCACCAGTTTCAGCCTAAGAACTTTTGGAATGGTCGCTGGAGGTCTGAATGGAAATTTACCATCTCGGGATCCACTGCTCAGTTGGTTCATTACTATGAGGATGGAAATGTTCAGTTAGTTAGCCACAAAGATGTGCAGGATCCATAACAATCTCTGGTGAAGCTCAAACCGCCNAGGAATTTGTAAAATTATAGAGCAAGCAGAGAGTGACTACCAGACTGCCATAAGCGAGACTATCAGAACATGTCAGACACAACTTTCAAAGCCTATCGCGGGCGGCTGCCCGTGACCCCCACCAGGACGACGGGGATAAAAAATCCAGCTACAAAATTGGGCAAAAAAAGCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGATTACGAAGATCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ830229
dbEST ID: 79647931
Trimmed Sequence: AGCGTTTTGCATCTCTTTGCCAATTTTGTAGCTGAGTATTTTATTCCAGTCGATCTTGGTGCGGGTCACTGGCAGCTGCCGGCGTAAGGCTTTGAAAGTTGTGTCTGACATGGTCTGATAGTTCTCGCTTATGGCAGTCTGGTAGTCACTCTCTGCTTGCTCTATAATTTTTACAAATTCCTTGGCGGTTTGAGCTTCACCAGAGATTGTTATGGATTCCTGCACATCTTTGTGGCTAACTAACTGAACATTTCCATCCTCATAGTAATGAACCAACTGAGCAGTGGATCCCGAGATGGTAAATTTCCATTCAGACCTCCAGCGACCATTCCAAAAGTTCTTAGGCTGAAACTGGTGGCTTTCAATACAAGATACTATTGTTTGCTGTCCATCTATTGTCTTTCCATAAACAGTGCAGACACCATTCGGATAGTGTTCTTTCACATATGCCCGCAAGGCCAAGTCACAAGCATCTCTCCAGGATTTTAAAGCCACATCACTGTCGTCAGGATGAGGATCACTAGCTTCTTTCCTTAAGTGATCAAACTTAAAGGTAATTCGATTCCGTGGATCCGGAAATCTGCTATTGCCAAGATCTCCATGCTCTGTTATAAGGACCTGGGTCATCAAGCCTTCGATTCTTTACAGGTGTTAAACTGATCCAGGTTATATTGGGGAAAAGGCATGGCGCTGGCTCCTTTCCTGAAAC
Full Trace Sequence: TGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCGTTTTGCATCTCTTTGCCAATTTTGTAGCTGAGTATTTTATTCCAGTCGATCTTGGTGCGGGTCACTGGCAGCTGCCGGCGTAAGGCTTTGAAAGTTGTGTCTGACATGGTCTGATAGTTCTCGCTTATGGCAGTCTGGTAGTCACTCTCTGCTTGCTCTATAATTTTTACAAATTCCTTGGCGGTTTGAGCTTCACCAGAGATTGTTATGGATTCCTGCACATCTTTGTGGCTAACTAACTGAACATTTCCATCCTCATAGTAATGAACCAACTGAGCAGTGGATCCCGAGATGGTAAATTTCCATTCAGACCTCCAGCGACCATTCCAAAAGTTCTTAGGCTGAAACTGGTGGCTTTCAATACAAGATACTATTGTTTGCTGTCCATCTATTGTCTTTCCATAAACAGTGCAGACACCATTCGGATAGTGTTCTTTCACATATGCCCGCAAGGCCAAGTCACAAGCATCTCTCCAGGATTTTAAAGCCACATCACTGTCGTCAGGATGAGGATCACTAGCTTCTTTCCTTAAGTGATCAAACTTAAAGGTAATTCGATTCCGTGGATCCGGAAATCTGCTATTGCCAAGATCTCCATGCTCTGTTATAAGGACCTGGGTCATCAAGCCTTCGATTCTTTACAGGTGTTAAACTGATCCAGGTTATATTGGGGAAAAGGCATGGCGCTGGCTCCTTTCCTGAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCGTTTTGCATCTCTTTGCC