ORFeome > carhsp1 ORF1 – XORFeome v1.0

carhsp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: carhsp1
Gene ID: 6253915
Gene Page ID: 489415
ORF Xenbase ID: 17267691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044047
Original XGC clone length: 303

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ824389
dbEST ID: 79642091
Trimmed Sequence: ATGACTTCAAACCCTACATCTCCAGGTACTTCTCCTTCTGACAGTTCCTCCATATCTCCTCAGTCTCCAACCAGAGACCCTTCATCTGCCAAGAACAAGAGACCGTTCTCCATCTCCTATGAGAGGATACCTCATCCCCAGCCCTCTCCCCACGAGACGAACAAGGACATTTTCTGCAACTGTACGTGCTGCTGAGGGACCTGTGTACAAAGGAGTCTGCAAAAGTTTTTCACGTTCCAAAGGTCACGGATTTATAACCCCAGAAGATGGAGGACCAGATATCTTCTTGCATATTTCTGAGTT
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCAAACCCTACATCTCCAGGTACTTCTCCTTCTGACAGTTCCTCCATATCTCCTCAGTCTCCAACCAGAGACCCTTCATCTGCCAAGAACAAGAGACCGTTCTCCATCTCCTATGAGAGGATACCTCATCCCCAGCCCTCTCCCCACGAGACGAACAAGGACATTTTCTGCAACTGTACGTGCTGCTGAGGGACCTGTGTACAAAGGAGTCTGCAAAAGTTTTTCACGTTCCAAAGGTCACGGATTTATAACCCCAGAAGATGGAGGACCAGATATCTTCTTGCATATTTCTGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAACAAAAAAAAAGTTACAAGACNTGGCTGTGTTATAAGGGAGCCTGACTTTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTACGCGGAGGCTGATATCCTCCACTTCTTCCCCGATAACAGAGACCGGCACACTGGCCATATCGGGTGGTCATCATGCGCCAGCTATCATCCCCGATATGCACCGCCGGGTAAAGTTCACGGGAAGATTTATCGAAAGGCAACTTGCATTGCCCAGGGGGGGATCCCAATCCTTCCTCCGGGGGGGGTTAAAAAAATCCCTTTGGTAAATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCAAACCCTACATCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829748
dbEST ID: 79647450
Trimmed Sequence: CTCAGAAATATGCAAGAAGATATCTGGTCCTCCATCTTCTGGGGTTATAAATCCGTGACCTTTGGAACGTGAAAAACTTTTGCAGACTCCTTTGTACACAGGTCCCTCAGCAGCACGTACAGTTGCAGAAAATGTCCTTGTTCGTCTCGTGGGGAGAGGGCTGGGGATGAGGTATCCTCTCATAGGAGATGGAGAACGGTCTCTTGTTCTTGGCAGATGAAGGGTCCTGGTTGGAGACTGAGGAGATATGGAGGAACTGTCAGAAGGAGAAGTACCTGGAGATGTAGGGTTTGAAGTCATGG
Full Trace Sequence: GGTCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAGAAATATGCAAGAAGATATCTGGTCCTCCATCTTCTGGGGTTATAAATCCGTGACCTTTGGAACGTGAAAAACTTTTGCAGACTCCTTTGTACACAGGTCCCTCAGCAGCACGTACAGTTGCAGAAAATGTCCTTGTTCGTCTCGTGGGGAGAGGGCTGGGGATGAGGTATCCTCTCATAGGAGATGGAGAACGGTCTCTTGTTCTTGGCAGATGAAGGGTCCTGGTTGGAGACTGAGGAGATATGGAGGAACTGTCAGAAGGAGAAGTACCTGGAGATGTAGGGTTTGAAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACAAAACGTCGTTTTACACTATGATGACTGGGGATTCACTCGGTCGTTCGTGCACGTAAAACCAGACCGTTAATGCTAAATATTACGGCCTTTGAAAGCACGTAACGTACAGTAAGCACAGGCTTTATCCGGACTTGATTCACATGCTTTGCCTGCCTGATGAATGCTCATCTGCATTTCGGTATGGCAATAAGGACGGTGAGCTGGGTGATACGGCAGGTGGTTCACCTTTTGTTACCCTTTTTCCCATAAGACAAACGGAAGCGTTTTCAATCCGGTCTGAATTTAAAACCCAAGAAACAAATTTACGGGCAGTTTTTCCTGAAGGAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGAAATATGCAAGAAGATATC