ORFeome > casp1 ORF1 – XORFeome v1.0

casp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: casp1
Gene ID: 6252623
Gene Page ID: 485194
ORF Xenbase ID: 17267739

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129548
Original XGC clone length: 1161

Human orthology & disease relationships

NCBI Entrez ID: 834
Ensembl gene IDs: ENSG00000137752
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,137750,137760,142680,151623,211980,275355,300068,308370,312300,313200,600274,601859,606657,606843,606889,607822,608354,608355

Library Location

Plate ID: GDExl11090
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838721
dbEST ID: 79656423
Trimmed Sequence: ATGACAGCTCAACTGAATAAAGTGCGCAGAGCCATTATAGATGGATGTAACCCTGCAATGATAAGTGATTTACTAGATGATTTGCGAGAAAAAAATGTACTTGTGGACTCCGAAGTGGAACACATCAAAGAGAGCAATAACACAAACAGGGACAGATGCCGGGCCATGATTGACAGTGTAAAGAAAAAAGGAGACGACCCAAGCAATATTCTACTTGAGAGCTTGGTGAAGAATCACAAAACTCTCGCCAAAAGCCTGGGACTCCACGAACCTCCTATGGCACCCGTGCCCATTCAAGAACATAATGCGGATACAATTAAGAACAAAGACATCAAAGGTGTAATTCCTTGTTCTGCTGAAGAATTCAAGAAAATTCAGGACACTCAAGGAGATAAGATTTATGATGTGCGGAAGCGTGAAGGACGGAAGGGCTTGGCTCTTATAATCTGCAATGAAAAGTTTGAGAATCTGAACGAGCGCCATGGAGCCAAGGTTGATCTGGATGGGATGACCAAATTACTAAATGAATTAGGATACCAAGTCCATCCACATACAAACTTGACAAAAAAAGAAATGGTGAAGGTGATGAAGGAATTTGCTGCCCAGGAGGAGCATGCAAATTCAGACAACACCTTCATAATTTTTATGTCCTCATGGAGATGGGAAGGGAGTCTGGGGGGAGGGACACCGAGAAGAACAAAAAAAAAAAAAAGAAAATTAGTAGGTG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGCTCAACTGAATAAAGTGCGCAGAGCCATTATAGATGGATGTAACCCTGCAATGATAAGTGATTTACTAGATGATTTGCGAGAAAAAAATGTACTTGTGGACTCCGAAGTGGAACACATCAAAGAGAGCAATAACACAAACAGGGACAGATGCCGGGCCATGATTGACAGTGTAAAGAAAAAAGGAGACGACCCAAGCAATATTCTACTTGAGAGCTTGGTGAAGAATCACAAAACTCTCGCCAAAAGCCTGGGACTCCACGAACCTCCTATGGCACCCGTGCCCATTCAAGAACATAATGCGGATACAATTAAGAACAAAGACATCAAAGGTGTAATTCCTTGTTCTGCTGAAGAATTCAAGAAAATTCAGGACACTCAAGGAGATAAGATTTATGATGTGCGGAAGCGTGAAGGACGGAAGGGCTTGGCTCTTATAATCTGCAATGAAAAGTTTGAGAATCTGAACGAGCGCCATGGAGCCAAGGTTGATCTGGATGGGATGACCAAATTACTAAATGAATTAGGATACCAAGTCCATCCACATACAAACTTGACAAAAAAAGAAATGGTGAAGGTGATGAAGGAATTTGCTGCCCAGGAGGAGCATGCAAATTCAGACAACACCTTCATAATTTTTATGTCCTCATGGAGATGGGAAGGGAGTCTGGGGGGAGGGACACCGAGAAGAACAAAAAAAAAAAAAAGAAAATTAGTAGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGCTCAACTGAATAAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838720
dbEST ID: 79656422
Trimmed Sequence: GTAGCCTGGGAAAAGGTAAAATTTCTTTGTCAGTGTACATCTCTCTTGTGTGGGCATCTGTGAGCGTGAGTTTGGGCATTTATCCTTAAACAAGGACTGCACTTCAAGAAAGATATCCCCCAGTGGTTGGCAATGAGCGTATTCATTCATTTTCTCAATCAGATGTGTGATGAACACGGAACCCTTTGTAGGATCTCTCCAAGAAACAGTGTCTGGAGTTGAAGAACAGAAGCATATAAAGTCTGCCTCTCTCTGGACAAAATGGAGCCCATCATCTTCCAGAGGGGGCGAAGCCACATCATCACGGACTAATAATCCACCTTTATTTTCCCCACGGCAGGCCTGAATAATGATGACTTTCGGTTTGTTCCGCAATTTAGAGCAATTGACATTATTGAATGTAGAAAAGATTTCATCGATCTCCAGCAGGTTAGTCACCTCATACTGTCCTTTTTCTTTTTCTGTCTTCTTGCTGTCTGTCCCACAGACTCCCTGCCTATCTCCATGAGACATCAGAACTATAAAGGTGCTGTCTGAATCTGCATGCTCCTCCTGGGCAGCAAACTCCTTCATCACCTCCACCATTTCTGTTTTTGGTCAGTTTTGTATGTGGATGGACTTGGTATCCTAATTTATTTAGTAATTTGGTCATCCCCACCCGATCAACCATGGCCTCCTGGCCCCTCGTCCAGATTCTCAACCTTTTCCTTTCCAAATTATAAGAGCCCA
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGCCTGGGAAAAGGTAAAATTTCTTTGTCAGTGTACATCTCTCTTGTGTGGGCATCTGTGAGCGTGAGTTTGGGCATTTATCCTTAAACAAGGACTGCACTTCAAGAAAGATATCCCCCAGTGGTTGGCAATGAGCGTATTCATTCATTTTCTCAATCAGATGTGTGATGAACACGGAACCCTTTGTAGGATCTCTCCAAGAAACAGTGTCTGGAGTTGAAGAACAGAAGCATATAAAGTCTGCCTCTCTCTGGACAAAATGGAGCCCATCATCTTCCAGAGGGGGCGAAGCCACATCATCACGGACTAATAATCCACCTTTATTTTCCCCACGGCAGGCCTGAATAATGATGACTTTCGGTTTGTTCCGCAATTTAGAGCAATTGACATTATTGAATGTAGAAAAGATTTCATCGATCTCCAGCAGGTTAGTCACCTCATACTGTCCTTTTTCTTTTTCTGTCTTCTTGCTGTCTGTCCCACAGACTCCCTGCCTATCTCCATGAGACATCAGAACTATAAAGGTGCTGTCTGAATCTGCATGCTCCTCCTGGGCAGCAAACTCCTTCATCACCTCCACCATTTCTGTTTTTGGTCAGTTTTGTATGTGGATGGACTTGGTATCCTAATTTATTTAGTAATTTGGTCATCCCCACCCGATCAACCATGGCCTCCTGGCCCCTCGTCCAGATTCTCAACCTTTTCCTTTCCAAATTATAAGAGCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGCCTGGGAAAAGGTAA