ORFeome > casp7 ORF1 – XORFeome v1.0

casp7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: casp7
Gene ID: 865041
Gene Page ID: 484040
ORF Xenbase ID: 17267769

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130126
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID: 840
Ensembl gene IDs: ENSG00000165806
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,137750,137760,142680,151623,162800,180849,188050,211980,217090,275355,300068,308370,312300,313200,600274,601859,606657,606843,606889,607271,607822,608354,608355

Library Location

Plate ID: GDExl11090
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838576
dbEST ID: 79656278
Trimmed Sequence: ATGGATGAGCAGCCGGAGGCTCTGGTGCCTGAATCTGACATCAAGGACGAGCCGGGGCCCGAGGAAGAGGAGGGTGAAGACTCAGTAGATGCCAAACCCGACAGAAGCCAGAGGATCTCCATATTCAGCAGCACCCAGCAGAAAAAGGCAGAGGAACCAGACAAGCCCCCCCAAACGAACGACAATGTGCGGATTGTTACCCCGGCTTTCCAGTACAAGATGAATTATGGGAAAGTTGGCAGATGCATCATAATTAACAACAAGAACTTCAATGAAGTCACAGGTATGAGCGCCCGCAATGGCACCGATATTGACGCCAGAGATTTACTCCGCTGCTTCAAGGGCCTCGGCTTTGACGTTAACGTGTACAACAACAAGAGCTGTGAGGAGATGGAGGCCCTCCTACATAGCGTGGCTCAGCAAGACCACAATGACAGCGCCTGTTTCGCCTGCATATTCCTGAGCCATGGGGAAGAGGGGCTGATCTATGGCACCGACGGGGCAATGCCCATAAAAGTACTGACCACTCTCTTCCGTGGGGACAAATGCAGGTCCCTTGTCGGGTAAACCCAACTGTTCTTCATTCCGGCCTGCATAAGGTGTGAATTTTATGATGGGTTGGAGGCAGATGCTGGGGCCGGCCAATGAAAACCTGGAAACGGAAGGCAATTCCAGGGCCCAAGATTCCCGTGGGAGGCGGATTTTTCTTTTTTCTTTTTGCCGTGGTCCGAGGGAAATTACTTTTTTCCGAAATCCCCGGCGAAGGGGAAACGTTGGGTTTCCGCCCAACCCCTCTTTTTCCAACCATTCCCTTTTGCCA
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAGCAGCCGGAGGCTCTGGTGCCTGAATCTGACATCAAGGACGAGCCGGGGCCCGAGGAAGAGGAGGGTGAAGACTCAGTAGATGCCAAACCCGACAGAAGCCAGAGGATCTCCATATTCAGCAGCACCCAGCAGAAAAAGGCAGAGGAACCAGACAAGCCCCCCCAAACGAACGACAATGTGCGGATTGTTACCCCGGCTTTCCAGTACAAGATGAATTATGGGAAAGTTGGCAGATGCATCATAATTAACAACAAGAACTTCAATGAAGTCACAGGTATGAGCGCCCGCAATGGCACCGATATTGACGCCAGAGATTTACTCCGCTGCTTCAAGGGCCTCGGCTTTGACGTTAACGTGTACAACAACAAGAGCTGTGAGGAGATGGAGGCCCTCCTACATAGCGTGGCTCAGCAAGACCACAATGACAGCGCCTGTTTCGCCTGCATATTCCTGAGCCATGGGGAAGAGGGGCTGATCTATGGCACCGACGGGGCAATGCCCATAAAAGTACTGACCACTCTCTTCCGTGGGGACAAATGCAGGTCCCTTGTCGGGTAAACCCAACTGTTCTTCATTCCGGCCTGCATAAGGTGTGAATTTTATGATGGGTTGGAGGCAGATGCTGGGGCCGGCCAATGAAAACCTGGAAACGGAAGGCAATTCCAGGGCCCAAGATTCCCGTGGGAGGCGGATTTTTCTTTTTTCTTTTTGCCGTGGTCCGAGGGAAATTACTTTTTTCCGAAATCCCCGGCGAAGGGGAAACGTTGGGTTTCCGCCCAACCCCTCTTTTTCCAACCATTCCCTTTTGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAGCAGCCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838575
dbEST ID: 79656277
Trimmed Sequence: ACAGGGTTTAAAGTAGAGTTCCTTTGTCAGCATAGAGACCACGCAAGGGATTTGCTTCTTCTTGTTGAATTGTGGGTCATCGCTATAGGATTCAAACTGGGTCGCCACCAGATAATTGACTCTGGTCAGGATCTGCATGACTTCCAGTTCTTTCCCGTATTCGTTAAGGACGTTGCAAAGAGCTTGGACGAACCAAGATCCCCTCCCGGGATTCCGCCAAGAGTAATATCCTGGTACAGTAGAATATGCAAAGAGAAAATCTGCCTCCACTGGAATCTTGTGCCTGGGATTGGCATCCGTCTCCAGGGTCTCATTCGCCGGCCCAGCATCTGCCTCCAACCCATCATCAAATTCACACCCTCTGCAGGCCTGAATGAAGAACAGTTTGGGTTTACCGACAAGGGACCTGCATTTGTCCCCACGGAAGAGAGTGGTCAGTACTTTTATGGGCATTGCCCCGTCGGTGCCATAGATCAGCCCCTCTTCCCCATGGCTCAGGAATATGCANGCGAAACAGGCGCTGTCATTGTGGTCTTGCTGAGCCACGCTATGTAGGAGGGCCTCCATCTCCTCACAGCTCTTGTTGGTGTACACGTTAAACCTCAAACCCAAGGCCCTTTAAACCAACGGATTAAATCCTCTGCCTTCATATCGGGTGGCTTTGGCGGGGCGCTCAAACTGGTGAACTCCATTGAAATTCCTGTGTGGTTATGTAGGGAGGCATGCGCCCCACCTTTTCCCCATTAATTTATTCCTTGTATCTGGGAA
Full Trace Sequence: GAAAAGGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGGGTTTAAAGTAGAGTTCCTTTGTCAGCATAGAGACCACGCAAGGGATTTGCTTCTTCTTGTTGAATTGTGGGTCATCGCTATAGGATTCAAACTGGGTCGCCACCAGATAATTGACTCTGGTCAGGATCTGCATGACTTCCAGTTCTTTCCCGTATTCGTTAAGGACGTTGCAAAGAGCTTGGACGAACCAAGATCCCCTCCCGGGATTCCGCCAAGAGTAATATCCTGGTACAGTAGAATATGCAAAGAGAAAATCTGCCTCCACTGGAATCTTGTGCCTGGGATTGGCATCCGTCTCCAGGGTCTCATTCGCCGGCCCAGCATCTGCCTCCAACCCATCATCAAATTCACACCCTCTGCAGGCCTGAATGAAGAACAGTTTGGGTTTACCGACAAGGGACCTGCATTTGTCCCCACGGAAGAGAGTGGTCAGTACTTTTATGGGCATTGCCCCGTCGGTGCCATAGATCAGCCCCTCTTCCCCATGGCTCAGGAATATGCANGCGAAACAGGCGCTGTCATTGTGGTCTTGCTGAGCCACGCTATGTAGGAGGGCCTCCATCTCCTCACAGCTCTTGTTGGTGTACACGTTAAACCTCAAACCCAAGGCCCTTTAAACCAACGGATTAAATCCTCTGCCTTCATATCGGGTGGCTTTGGCGGGGCGCTCAAACTGGTGAACTCCATTGAAATTCCTGTGTGGTTATGTAGGGAGGCATGCGCCCCACCTTTTCCCCATTAATTTATTCCTTGTATCTGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGGTTTAAAGTAGAGTTCC