ORFeome > cav3.2 ORF1 – XORFeome v1.0

cav3.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cav3.2
Gene ID: 5815140
Gene Page ID: 5815089
ORF Xenbase ID: 17267811

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041289
Original XGC clone length: 462

Human orthology & disease relationships

NCBI Entrez ID: 859
Ensembl gene IDs: ENSG00000182533,LRG_329
Directly associated (OMIM) disease MIM numbers: 123320,192600,606072,607801,611818,614321
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,192600,202400,207800,207900,215700,226650,226730,273800,311250,601419,604765,606072,607801,608758

Library Location

Plate ID: GDExl11007
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ823618
dbEST ID: 79641320
Trimmed Sequence: ATGGCACAAATCCAACAACCAGAACCAGCAAAGCAGGACAAATCAAACACGGAGGCATTAACTAAAGAGATAGACCTGGTGCAAAGGGACCCCAAGAAGATCAACCAGGAGGTGGTACAAGTGGACTTTGAAGATGTGATTGCAGAGCCGGATGGCACTCACAGTTTTGATGGAGTGTGGAAGGCCAGCAGCTCTACCTTCACCGTGACCAAATACTGGTGCTACAGAGTGCTCTCTGCTATCTTTGGACTGCCTTTGGCACTGCTCTGGGGCTTTCTCTTCGCTTGCTTGTCTTTCTGCCAAATCTGGGCTGTGGTCCCTTGTGTTAAGAGCTATCTAATGGAAGTGCAATGCCTTGGACAGTTCTATGCCCTCTGTGTTCGCACCTTCTGTGACCCAATATTTGAGGCCATGGGAAAGGTTCTGGGTGGAATACGTGTAGCACTCAGAAAAGAAGCGTT
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAAATCCAACAACCAGAACCAGCAAAGCAGGACAAATCAAACACGGAGGCATTAACTAAAGAGATAGACCTGGTGCAAAGGGACCCCAAGAAGATCAACCAGGAGGTGGTACAAGTGGACTTTGAAGATGTGATTGCAGAGCCGGATGGCACTCACAGTTTTGATGGAGTGTGGAAGGCCAGCAGCTCTACCTTCACCGTGACCAAATACTGGTGCTACAGAGTGCTCTCTGCTATCTTTGGACTGCCTTTGGCACTGCTCTGGGGCTTTCTCTTCGCTTGCTTGTCTTTCTGCCAAATCTGGGCTGTGGTCCCTTGTGTTAAGAGCTATCTAATGGAAGTGCAATGCCTTGGACAGTTCTATGCCCTCTGTGTTCGCACCTTCTGTGACCCAATATTTGAGGCCATGGGAAAGGTTCTGGGTGGAATACGTGTAGCACTCAGAAAAGAAGCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAGCTCATCTTCCTCAGAGTATTAAAAACNCNCCGGGTTGTGCCCTCCGGGGGTCTTTTTCCCGGGTAGCTTTTTTCTTGTTGGCGGCCGTGCGGTGGGTTGGGGGGGATCTCCCTTCCTCCCCCCCGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAAATCCAACAACCAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828917
dbEST ID: 79646619
Trimmed Sequence: CGCTTCTTTTCTGAGTGCTACACGTATTCCACCCAGAACCTTTCCCATGGCCTCAAATATTGGGTCACAGAAGGTGCGAACACAGAGGGCATAGAACTGTCCAAGGCATTGCACTTCCATTAGATAGCTCTTAACACAAGGGACCACAGCCCAGATTTGGCAGAAAGACAAGCAAGCGAAGAGAAAGCCCCAGAGCAGTGCCAAAGGCAGTCCAAAGATAGCAGAGAGCACTCTGTAGCACCAGTATTTGGTCACGGTGAAGGTAGAGCTGCTGGCCTTCCACACTCCATCAAAACTGTGAGTGCCATCCGGCTCTGCAATCACATCTTCAAAGTCCACTTGTACCACCTCCTGGTTGATCTTCTTGGGGTCCCTTTGCACCAGGTCTATCTCTTTAGTTAATGCCTCCGTGTTTGATTTGTCCTGCTTTGCTGGTTCTGGTTGTTGAATTTGTGCCATGG
Full Trace Sequence: CTGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCTTCTTTTCTGAGTGCTACACGTATTCCACCCAGAACCTTTCCCATGGCCTCAAATATTGGGTCACAGAAGGTGCGAACACAGAGGGCATAGAACTGTCCAAGGCATTGCACTTCCATTAGATAGCTCTTAACACAAGGGACCACAGCCCAGATTTGGCAGAAAGACAAGCAAGCGAAGAGAAAGCCCCAGAGCAGTGCCAAAGGCAGTCCAAAGATAGCAGAGAGCACTCTGTAGCACCAGTATTTGGTCACGGTGAAGGTAGAGCTGCTGGCCTTCCACACTCCATCAAAACTGTGAGTGCCATCCGGCTCTGCAATCACATCTTCAAAGTCCACTTGTACCACCTCCTGGTTGATCTTCTTGGGGTCCCTTTGCACCAGGTCTATCTCTTTAGTTAATGCCTCCGTGTTTGATTTGTCCTGCTTTGCTGGTTCTGGTTGTTGAATTTGTGCCATGGTGCCAACTTTTTTGTACAAATTTGGCATTATAAAAGAGCATTGCTCATCAATTTGTTGCACCGAACAGGTCACTATCAGTCAAAAAAAAATCATTATTTGCGGTCCAAAAAAAAAACTGGGCGTCGTTTCACACACCAGGGACGTGGAAGTTCCCGGGGGAGCTCGGGACCTGGGTAACAAAGTTCACCCATGTTTAAAACAGTTTTCCCAGAGCACAACCGGGAAACGTTTTTCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTCTTTTCTGAGTGCTA