ORFeome > cbln2 ORF1 – XORFeome v1.0

cbln2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cbln2
Gene ID: 5897899
Gene Page ID: 5897870
ORF Xenbase ID: 17267841

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054217
Original XGC clone length: 657

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ839273
dbEST ID: 79656975
Trimmed Sequence: ATGATTCAGGAGGAGAATGGCGCAGGAGAGAGGGAAGCTGAAGGGCTAAAGCCTTGGAGATGGAGCTTGCACTTAGTTACTAAACTGGCGCTGTCCATTGTGCTGATGCTCTTTGCGCCCCCTCTGGTGAATGCTCAGAATGACACGGAGCCTATCGTGCTGGAAGGCAAGTGCCTGGTGGTCTGCGACTCCAGCCCGTCTTCTGATGGAGCCGTCACCTCGTCTTTAGGGATCTCAGTTCGCTCTGGGAGTGCCAAGGTCGCCTTCTCAGCCATTAGGAGCACCAACCATGAGCCGTCTGACATGAGCAATCGCACCAACACTATCTATTTTGATCAGGTGCTAGTAAATGTTGGCAATCACTTTGACCTTGCGTCCAGCGGATTTCTAGCGCCAAGGAAGGGGATCTATAGCTTCAGTTTTCACGTGGTGAAGGTGTACAACAGACAAACGATTCAGGTAAGTCTAATGCAGAACGACTACCCAGTGATCTCTGCCTTTGCTGGGGACCAGGATGTGACCAGAGAAGCAGCCAGTAATGGAGTTCTCCTGCACATGGAAAGAGCTGATAAAGTACACCTAAGACTGGAGAGAGGGAACCTCATGGGAGGTTGGCAATATTCCACCTTCTCTGGCTTTTTAGTTTTTTCCCTTTTT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCAGGAGGAGAATGGCGCAGGAGAGAGGGAAGCTGAAGGGCTAAAGCCTTGGAGATGGAGCTTGCACTTAGTTACTAAACTGGCGCTGTCCATTGTGCTGATGCTCTTTGCGCCCCCTCTGGTGAATGCTCAGAATGACACGGAGCCTATCGTGCTGGAAGGCAAGTGCCTGGTGGTCTGCGACTCCAGCCCGTCTTCTGATGGAGCCGTCACCTCGTCTTTAGGGATCTCAGTTCGCTCTGGGAGTGCCAAGGTCGCCTTCTCAGCCATTAGGAGCACCAACCATGAGCCGTCTGACATGAGCAATCGCACCAACACTATCTATTTTGATCAGGTGCTAGTAAATGTTGGCAATCACTTTGACCTTGCGTCCAGCGGATTTCTAGCGCCAAGGAAGGGGATCTATAGCTTCAGTTTTCACGTGGTGAAGGTGTACAACAGACAAACGATTCAGGTAAGTCTAATGCAGAACGACTACCCAGTGATCTCTGCCTTTGCTGGGGACCAGGATGTGACCAGAGAAGCAGCCAGTAATGGAGTTCTCCTGCACATGGAAAGAGCTGATAAAGTACACCTAAGACTGGAGAGAGGGAACCTCATGGGAGGTTGGCAATATTCCACCTTCTCTGGCTTTTTAGTTTTTTCCCTTTTTGCCAACTTTCTTGTACAAAGTTTGGCTTATAAAAAAAGCATTGGCTTTATCATTTTGTTGCCAACGAACAGGTTCACTATCAGTCCAAAATAAAATCCTTATTTTGCCATCCCAGCCTGAATATCCCCCCTATAGGTGGAGTCCGTTTTTTTCCTTGGGGGCAATAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCAGGAGGAGAATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839272
dbEST ID: 79656974
Trimmed Sequence: AAGGGGAAAAACTAAAAAGCCAGAGAAGGTGGAATATTGCCAACCTCCCATGAGGTTCCCTCTCTCCAGTCTTAGGTGTACTTTATCAGCTCTTTCCATGTGCAGGAGAACTCCATTACTGGCTGCTTCTCTGGTCACATCCTGGTCCCCAGCAAAGGCAGAGATCACTGGGTAGTCGTTCTGCATTAGACTTACCTGAATCGTTTGTCTGTTGTACACCTTCACCACGTGAAAACTGAAGCTATAGATCCCCTTCCTTGGCGCTAGAAATCCGCTGGACGCAAGGTCAAAGTGATTGCCAACATTTACTAGCACCTGATCAAAATAGATAGTGTTGGTGCGATTGCTCATGTCAGACGGCTCATGGTTGGTGCTCCTAATGGCTGAGAAGGCGACCTTGGCACTCCCAGAGCGAACTGAGATCCCTAAAGACGAGGTGACGGCTCCATCAGAAGACGGGCTGGAGTCGCAGACCACCACGCACTTGCCTTCCAGCACGATAGGCTCCGTGTCATTCTGAGCATTCACCAGAAGGGGGCGCAAAGAGCATCAGCACAATGGACAGCGCCAGTTTAGTAACTAAGTGCAAGCTCCATCTTCAAGGCTTTAACCCTTCCGCTTTCCCTCTCCCCTGGCGCATTCCCCTCCGAAATTCTGGGGGCAACTTTTTTTGGAACAAGTTTGGGATTTATAAAAAAAGCCTTTGGTCATTAAATTTTTTTGCCAACGAAAAGGGGTCCCTAATTAGGTTCAAAAAAAAAATCCATTTTTTTTTG
Full Trace Sequence: GGGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGGGAAAAACTAAAAAGCCAGAGAAGGTGGAATATTGCCAACCTCCCATGAGGTTCCCTCTCTCCAGTCTTAGGTGTACTTTATCAGCTCTTTCCATGTGCAGGAGAACTCCATTACTGGCTGCTTCTCTGGTCACATCCTGGTCCCCAGCAAAGGCAGAGATCACTGGGTAGTCGTTCTGCATTAGACTTACCTGAATCGTTTGTCTGTTGTACACCTTCACCACGTGAAAACTGAAGCTATAGATCCCCTTCCTTGGCGCTAGAAATCCGCTGGACGCAAGGTCAAAGTGATTGCCAACATTTACTAGCACCTGATCAAAATAGATAGTGTTGGTGCGATTGCTCATGTCAGACGGCTCATGGTTGGTGCTCCTAATGGCTGAGAAGGCGACCTTGGCACTCCCAGAGCGAACTGAGATCCCTAAAGACGAGGTGACGGCTCCATCAGAAGACGGGCTGGAGTCGCAGACCACCACGCACTTGCCTTCCAGCACGATAGGCTCCGTGTCATTCTGAGCATTCACCAGAAGGGGGCGCAAAGAGCATCAGCACAATGGACAGCGCCAGTTTAGTAACTAAGTGCAAGCTCCATCTTCAAGGCTTTAACCCTTCCGCTTTCCCTCTCCCCTGGCGCATTCCCCTCCGAAATTCTGGGGGCAACTTTTTTTGGAACAAGTTTGGGATTTATAAAAAAAGCCTTTGGTCATTAAATTTTTTTGCCAACGAAAAGGGGTCCCTAATTAGGTTCAAAAAAAAAATCCATTTTTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGGGAAAAACTAAAAAGCCAGA