ORFeome > cbln4 ORF1 – XORFeome v1.0

cbln4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cbln4
Gene ID: 986707
Gene Page ID: 986702
ORF Xenbase ID: 17267847

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC056851
Original XGC clone length: 618

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ839261
dbEST ID: 79656963
Trimmed Sequence: ATGGTGCTGAACACAATGCGTCCCTATACGGAGCTCTCCCTGGTGCTGAAGCTGCTCTTGGCTCTACTACTCTGCGTCCTCCCAGCTCGGGGACAGAATGACACAAAACCTATAGTCCTAAAAGGAAAATGCTTAGTCGTGTGCGACTCCAACCCTACCACTGACACCAAAGGATCTTCATCTTCTCCTCTTGGGATCTCTGTGAGAGCTGCTAACTCCAAGGTTGCCTTTTCAGCTGTTCGGAGCACCAATCATGAGCCCTCCAAAATGAGCAACAAAACTAGGATTATCTATTTTGACCAAATCTTAGTAAATGTCGGGAACTTTTTCACTCTGGAATCAGTGTTTGTTGCCCCAAGGAAAGGCATTTACAGCTTCAGCTTTCATGTCATAAAAGTTTATCAAAGTCAAACTATACAGGTAAACCTGATGCTTAATGGAAAACCAGTCATTTCAGCATTTGCTGGGGACAAAGACTTGACTCGTGAAGCACCCACAAATAGCGTCCTTCTGTATTTGGATAAGGAAGACAAGGTTTATCTGAAACTGGAGAAAGGTAATTTAGTCGGTGGCTGGCAATACTCAACCTTCTCTGGCTTTTTGGTGTTTCCCCTGTTGCCCCTTTTCTTGTTCAAAGTTGGAATTATAAAAAAGCTTTTGCTATCAATTTTTTGCAACAAAAAGTTCACTATCATTCAAAAAAAAATTCATATTTTTCCATCCCACCT
Full Trace Sequence: GTGAGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCTGAACACAATGCGTCCCTATACGGAGCTCTCCCTGGTGCTGAAGCTGCTCTTGGCTCTACTACTCTGCGTCCTCCCAGCTCGGGGACAGAATGACACAAAACCTATAGTCCTAAAAGGAAAATGCTTAGTCGTGTGCGACTCCAACCCTACCACTGACACCAAAGGATCTTCATCTTCTCCTCTTGGGATCTCTGTGAGAGCTGCTAACTCCAAGGTTGCCTTTTCAGCTGTTCGGAGCACCAATCATGAGCCCTCCAAAATGAGCAACAAAACTAGGATTATCTATTTTGACCAAATCTTAGTAAATGTCGGGAACTTTTTCACTCTGGAATCAGTGTTTGTTGCCCCAAGGAAAGGCATTTACAGCTTCAGCTTTCATGTCATAAAAGTTTATCAAAGTCAAACTATACAGGTAAACCTGATGCTTAATGGAAAACCAGTCATTTCAGCATTTGCTGGGGACAAAGACTTGACTCGTGAAGCACCCACAAATAGCGTCCTTCTGTATTTGGATAAGGAAGACAAGGTTTATCTGAAACTGGAGAAAGGTAATTTAGTCGGTGGCTGGCAATACTCAACCTTCTCTGGCTTTTTGGTGTTTCCCCTGTTGCCCCTTTTCTTGTTCAAAGTTGGAATTATAAAAAAGCTTTTGCTATCAATTTTTTGCAACAAAAAGTTCACTATCATTCAAAAAAAAATTCATATTTTTCCATCCCACCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCTGAACACAATGCGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCAGGGATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGGGAAACACCAAAAAGCCAAAAAAGGTTGAGTATTGCCAGCCACCGACTAAATTACCTTTCTCCAGTTTCAAATAAACCTTGTCTTCCTTATCCAAATACAAAAGGACGCTATTTGTGGCTGCTTCACGAGTCACGTCTTTGTCCCCAGCAAATGCTGAAATGACTGGTTTTCCATTAAGCATCAGGTTTACCTGTATAGTCTGACTCTGATAAACTTTTATGACATGAAAGCTGAACCTGTAAATGCCTTTCCTTGGGGCAACAAACACTGATTCCAAAGTGAAAAAGTTCCCAACATTTACTAAAATCTGGTCAAAATAAATAATCCTAGTTTTGTTGCTCATTTCGGAGGGCTCATGATTGGTGCTCCAAACAGCTAAAAAGGCAACCTTGGATTTAGCAGCTCTCACAAAAATCCCAAAAGGAGAAGATGAAAATCCTTTGGTGTCAGTGGTAGGGTTGGAGTCGCACACGACTAAGCATTTTCCTTCTAGGACTATAGGTTCTGTGTCATTCTGTCCCCCACCTGGGAGGACGCAAATAAGTAAAGCAAAAAGCAGCTTCACCACCAGGGAGAACTCCGTAAGGGAACCCATGTGTTCAGCACCATGGTGCCAACTTTTTGGTACAAAGTTGGCATTTAAAAAAAAGCATTGCTAAACCTTTTTTTGGCAACAAAACAGGTTCCTAAAAAAAAAAAAATAAAAACACATAAATTTGGGGTCCCGAACCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGGGAAACACCAAAAAGCCA