ORFeome > cbx5 ORF1 – XORFeome v1.0

cbx5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cbx5
Gene ID: 972733
Gene Page ID: 972726
ORF Xenbase ID: 17267907

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054962
Original XGC clone length: 600

Human orthology & disease relationships

NCBI Entrez ID: 23468
Ensembl gene IDs: ENSG00000094916
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 233300,260500,608115

Library Location

Plate ID: GDExl11002
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ839357
dbEST ID: 79657059
Trimmed Sequence: ATGGACGCCAGTGACACTTCTACAGGTCCAAGGCCCAATAGGGAGAGCACAGTGGGCAAAAAGAGCAAAAGAGCATCAGATGCCTCCTCCTCTGAGGAAGAAGAGTATGTTGTGGAAAAGGTTCTTGATCGAAGAGTGGTAAAGGGACAAGTAGAATACCTTCTAAAGTGGAAAGGTTTCTCAGAGGAGCATAACACTTGGGAGCCAGAAAAAAACCTTGATTGTCCAGAACTCATCTCTGAGTTTATGAAGAAGTACAAGAAAGCGAAGGAGGCTGAGCCAAAAGCCAAGACGGAAAGCACCAAAAGGAAAGCTGGAAGTGACGACATTAAGGCAAAGAGGAGGAGAGAGAGCAATGACATCGCACGGGGCTTCGAAAGAGGTTTGGAGCCAGAAAAGATCATTGGTGCTACAGATTCTTGTGGTGAGCTGATGTTTCTCATGAAATGGAAAGACTCAGATGAAGCTGACCTGGTGCTTGCTAAGGAAGCCAACCTGAAATGCCCACAGATTGTTATAGCATTTTATGAGGAGAGACTGACTTGGCATGCCTATCCTGAAGAGTCAGAAAGCAAAGAANAGGAAGCGGTGAAAATTTT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGCCAGTGACACTTCTACAGGTCCAAGGCCCAATAGGGAGAGCACAGTGGGCAAAAAGAGCAAAAGAGCATCAGATGCCTCCTCCTCTGAGGAAGAAGAGTATGTTGTGGAAAAGGTTCTTGATCGAAGAGTGGTAAAGGGACAAGTAGAATACCTTCTAAAGTGGAAAGGTTTCTCAGAGGAGCATAACACTTGGGAGCCAGAAAAAAACCTTGATTGTCCAGAACTCATCTCTGAGTTTATGAAGAAGTACAAGAAAGCGAAGGAGGCTGAGCCAAAAGCCAAGACGGAAAGCACCAAAAGGAAAGCTGGAAGTGACGACATTAAGGCAAAGAGGAGGAGAGAGAGCAATGACATCGCACGGGGCTTCGAAAGAGGTTTGGAGCCAGAAAAGATCATTGGTGCTACAGATTCTTGTGGTGAGCTGATGTTTCTCATGAAATGGAAAGACTCAGATGAAGCTGACCTGGTGCTTGCTAAGGAAGCCAACCTGAAATGCCCACAGATTGTTATAGCATTTTATGAGGAGAGACTGACTTGGCATGCCTATCCTGAAGAGTCAGAAAGCAAAGAANAGGAAGCGGTGAAAATTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAAATAAAACATTTTTTTGCCATCCCCCTTAATTTCCCCATTAATGAAGTCGTAATAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAATTATGACCCCCGGGTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGCCAGTGACACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839356
dbEST ID: 79657058
Trimmed Sequence: ACTTTTCACCGCTTCCTTTTCTTTGCTTTCTGACTCTTCAGGATAGGCATGCCAAGTCAGTCTCTCCTCATAAAATGCTATAACAATCTGTGGGCATTTCAGGTTGGCTTCCTTAGCAAGCACCAGGTCAGCTTCATCTGAGTCTTTCCATTTCATGAGAAACATCAGCTCACCACAAGAATCTGTAGCACCAATGATCTTTTCTGGCTCCAAACCTCTTTCGAAGCCCCGTGCGATGTCATTGCTCTCTCTCCTCCTCTTTGCCTTAATGTCGTCACTTCCAGCTTTCCTTTTGGTGCTTTCCGTCTTGGCTTTTGGCTCAGCCTCCTTCGCTTTCTTGTACTTCTTCATAAACTCAGAGATGAGTTCTGGACAATCAAGGTTTTTTTCTGGCTCCCAAGTGTTATGCTCCTCTGAGAAACCTTTCCACTTTAGAAGGTATTCTACTTGTCCCTTTACCACTCTTCGATCAAGAACCTTTTCCACAACATACTCTTCTTCCTCAGAGGAGGAGGCATCTGATGCTCTTTTGCTCTTTTTGCCCACTGTGCTCTTCCTATGGGGCCCTGGAACTGTAGAAGTGTCACTGGCGTCCATGGGGCCCACTTTTTTTGAAAAAGTTGGCATTTATAAAAAGCCATTGCTTCATCAATTTTTTGCAACAAAAAGGGAAAAAAATAAAAAAAAAAAAAATTCATTATTTTGGGGGCCCAAGCCTTAAAAACAGGGACCGTCTAATTTAAAAAAAA
Full Trace Sequence: GGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTTTCACCGCTTCCTTTTCTTTGCTTTCTGACTCTTCAGGATAGGCATGCCAAGTCAGTCTCTCCTCATAAAATGCTATAACAATCTGTGGGCATTTCAGGTTGGCTTCCTTAGCAAGCACCAGGTCAGCTTCATCTGAGTCTTTCCATTTCATGAGAAACATCAGCTCACCACAAGAATCTGTAGCACCAATGATCTTTTCTGGCTCCAAACCTCTTTCGAAGCCCCGTGCGATGTCATTGCTCTCTCTCCTCCTCTTTGCCTTAATGTCGTCACTTCCAGCTTTCCTTTTGGTGCTTTCCGTCTTGGCTTTTGGCTCAGCCTCCTTCGCTTTCTTGTACTTCTTCATAAACTCAGAGATGAGTTCTGGACAATCAAGGTTTTTTTCTGGCTCCCAAGTGTTATGCTCCTCTGAGAAACCTTTCCACTTTAGAAGGTATTCTACTTGTCCCTTTACCACTCTTCGATCAAGAACCTTTTCCACAACATACTCTTCTTCCTCAGAGGAGGAGGCATCTGATGCTCTTTTGCTCTTTTTGCCCACTGTGCTCTTCCTATGGGGCCCTGGAACTGTAGAAGTGTCACTGGCGTCCATGGGGCCCACTTTTTTTGAAAAAGTTGGCATTTATAAAAAGCCATTGCTTCATCAATTTTTTGCAACAAAAAGGGAAAAAAATAAAAAAAAAAAAAATTCATTATTTTGGGGGCCCAAGCCTTAAAAACAGGGACCGTCTAATTTAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTTTCACCGCTTCCTTTTCT