ORFeome > cc2d1b ORF1 – XORFeome v1.0

cc2d1b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cc2d1b
Gene ID: 997991
Gene Page ID: 997987
ORF Xenbase ID: 17267931

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057723
Original XGC clone length: 2595

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ824530
dbEST ID: 79642232
Trimmed Sequence: ATGTTGGGGAGGAAGCTAGGCAAAAAGACTGCTCAGGCCAAGGGCCGAGGTGCTGCTGCTGCAAAGGAGTTGGGGCTCTTTGTAGATTTCAGTCCAGAGGATATGATGCTTGGCATTCCAGATGACCCAGACGATGGAGACCTGGAAGCTGAATTGGCAGCTTTAACTGGAGTAAAGGCAGTATCAAAACCAAAGCCTAAAGGGAAAGCCCCTCTCCCTATGGAAGAGATTGAGAAGATGGCGCAGGATTGTATGACAGACATGACTGGGGAGGATGACGACGACGATTTGGAAGAAGATGAAGAATTGCTGGCTGAGCTACAGGATGTTGTTGGTGAGGAAGAGGAGGTGGAACAGTCACAGCCTAGTGATACTGAAGAGTCAGAGCCTTCTGCATCTGAGACACAGGAACACACAGAGCCTGAACAGCAAGTCAACTCTTCAGTAGCAGAAATTCAACATAATTTACAGGTCCCTGCTGGAGGAATGCTCCAGGTTTTAGAAGAACGGATTGGCAATTACAAGGAAGCAATCAGCAATGCCAAACTGTCCAATGAGAGTGCCAAGGCTAGACGCTATGAACGGGGGCTAAAGACACTTGAATCTATGCTAAGTGCTGCAAGGCAAGGGAGGACAGTAATTGAGGCAGATATCCCACCTCCAGTGGCTTGTGGGAAACCTGCTGNTAGCCCAACAACTGATGTTCCNANNCACTGACACAGCNAGCAAGGGGCTGGGAGATTTTGAACGATGTACCAATGGAAACCACAGGAGGCTGTTACAAACCTTGTAAAGACCAAAGGAACCCTTGTCAAATAAGGCCCAAACTTAATGGGATG
Full Trace Sequence: TAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGGGAGGAAGCTAGGCAAAAAGACTGCTCAGGCCAAGGGCCGAGGTGCTGCTGCTGCAAAGGAGTTGGGGCTCTTTGTAGATTTCAGTCCAGAGGATATGATGCTTGGCATTCCAGATGACCCAGACGATGGAGACCTGGAAGCTGAATTGGCAGCTTTAACTGGAGTAAAGGCAGTATCAAAACCAAAGCCTAAAGGGAAAGCCCCTCTCCCTATGGAAGAGATTGAGAAGATGGCGCAGGATTGTATGACAGACATGACTGGGGAGGATGACGACGACGATTTGGAAGAAGATGAAGAATTGCTGGCTGAGCTACAGGATGTTGTTGGTGAGGAAGAGGAGGTGGAACAGTCACAGCCTAGTGATACTGAAGAGTCAGAGCCTTCTGCATCTGAGACACAGGAACACACAGAGCCTGAACAGCAAGTCAACTCTTCAGTAGCAGAAATTCAACATAATTTACAGGTCCCTGCTGGAGGAATGCTCCAGGTTTTAGAAGAACGGATTGGCAATTACAAGGAAGCAATCAGCAATGCCAAACTGTCCAATGAGAGTGCCAAGGCTAGACGCTATGAACGGGGGCTAAAGACACTTGAATCTATGCTAAGTGCTGCAAGGCAAGGGAGGACAGTAATTGAGGCAGATATCCCACCTCCAGTGGCTTGTGGGAAACCTGCTGNTAGCCCAACAACTGATGTTCCNANNCACTGACACAGCNAGCAAGGGGCTGGGAGATTTTGAACGATGTACCAATGGAAACCACAGGAGGCTGTTACAAACCTTGTAAAGACCAAAGGAACCCTTGTCAAATAAGGCCCAAACTTAATGGGATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGGGAGGAAGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829881
dbEST ID: 79647583
Trimmed Sequence: CTTTCGAGGAACATGTCCCATCACCAGCCACTTCTCAGTCACCACCTGAAGGTCCTGGCCATTTAGAGGATCCCTTAGCCGCACCTTAATTTCCAATTTACCACCAGTCGGCTTCCTACCGTCAAAAACCTCTACGATCTCTCGGATCTCACACTGAGTCTCCAGCTTGTCCAGTTTTACACTCGCAGATCCAACCTGTTTATCACTTCTCACAAGAAAAAACCCCTTGTGAAAGATTTCAAACTTGATGCCTTTGGTCTGAATGACTCGTTTGAAGCCCCTGTGATTCCGGTTTATGTTTAGTTTGAATGACTGTTCATATTCTGGGGAGTTGGTGTTTTTAATTACCAAGGTTTTATTTTTTTGAGGCTGTTCCGAGCTTGGATATGGAAATTCAAACTTCACATAGGCATCCAAATCATTGGGCGCGACTCCTGATGGGGCTGGTAAGTTAATTCCACGTACAATGATTAGTAGCATTTCTGTGCTGCTGAGCTCAGAGAAAACCCTGACGATTTTTAATGTCTTGTCTTCAAAGTGGTAGGGAGGAGGGTCAAGGCCTTGAGCTTGGGACAGCTGAAGGATCTCACAGTTTTTCTTGCAGTCCTCAGCCATATTCTCAAACCTTGTGGTTTCTGCAACATTGCCCCATCTGTGTAAACTGCTTTGAATAACGTATGCATTTTCTCATGCTGTTTCATGCAGGGN
Full Trace Sequence: CCGGGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTCGAGGAACATGTCCCATCACCAGCCACTTCTCAGTCACCACCTGAAGGTCCTGGCCATTTAGAGGATCCCTTAGCCGCACCTTAATTTCCAATTTACCACCAGTCGGCTTCCTACCGTCAAAAACCTCTACGATCTCTCGGATCTCACACTGAGTCTCCAGCTTGTCCAGTTTTACACTCGCAGATCCAACCTGTTTATCACTTCTCACAAGAAAAAACCCCTTGTGAAAGATTTCAAACTTGATGCCTTTGGTCTGAATGACTCGTTTGAAGCCCCTGTGATTCCGGTTTATGTTTAGTTTGAATGACTGTTCATATTCTGGGGAGTTGGTGTTTTTAATTACCAAGGTTTTATTTTTTTGAGGCTGTTCCGAGCTTGGATATGGAAATTCAAACTTCACATAGGCATCCAAATCATTGGGCGCGACTCCTGATGGGGCTGGTAAGTTAATTCCACGTACAATGATTAGTAGCATTTCTGTGCTGCTGAGCTCAGAGAAAACCCTGACGATTTTTAATGTCTTGTCTTCAAAGTGGTAGGGAGGAGGGTCAAGGCCTTGAGCTTGGGACAGCTGAAGGATCTCACAGTTTTTCTTGCAGTCCTCAGCCATATTCTCAAACCTTGTGGTTTCTGCAACATTGCCCCATCTGTGTAAACTGCTTTGAATAACGTATGCATTTTCTCATGCTGTTTCATGCAGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCGAGGAACATGTCCCA