ORFeome > ccdc176 ORF1 – XORFeome v1.0

ccdc176 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccdc176
Gene ID: 5831975
Gene Page ID: 5831964
ORF Xenbase ID: 17268021

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126050
Original XGC clone length: 1596

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ837769
dbEST ID: 79655471
Trimmed Sequence: ATGCCTAAACTCAAAGTGAAAGCTGGAAAGGGAAAGAAGGGTAAAAGGAAAAAGGCTGGGAAAAATGAACACAGATTGGACAAAGAATCTGAAGTAGAGAGAGCCAGGTCTAATGCTGCACTTTGGGAGGCGAGGCTGAAAGTAACTGAATTTTCTCGTGTTGAGTATCGAGATGCAACTCGAAGTTTGGCCCATAACAATGAAGATCTCACAAAGCAACAATATAAACTACAAAAGGAAATAGTGGAGGTCTTTGGGTTCTTGAAAATGCACGACTTGTAATAACGATGAGCTCATTGTTATGTTACATCACCACATAATTTCATACAAAGGATCGGGTCTGACAACTTTACAGGACATCTTGAATATTAAGCCAAAAAATTGCTTACCTCTTTGCTGCATCCAACAGGTCACTATCTTTTCTAATCAAATCATTATTTACGAACCACCTTATATCATCAATACCGAACCACACCACGTGCATCTTAGCTCGTCCTAGGAAGCACTAGTAAGAGTCACTTATATCTAGTAGTACAATAGAAAAAGACAGAAACAATCAATTAAAAAATAAAATATACAAAAAAACGAAATGCCTTATATTAACACTATTGACTTTCTAATAGCTAGCTACTGGCAGATACAAACCTTCTAAGATAAAACCATTATTGTAAAACCCAATAAAAAACCCCANNTGGGAAGATACA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTAAACTCAAAGTGAAAGCTGGAAAGGGAAAGAAGGGTAAAAGGAAAAAGGCTGGGAAAAATGAACACAGATTGGACAAAGAATCTGAAGTAGAGAGAGCCAGGTCTAATGCTGCACTTTGGGAGGCGAGGCTGAAAGTAACTGAATTTTCTCGTGTTGAGTATCGAGATGCAACTCGAAGTTTGGCCCATAACAATGAAGATCTCACAAAGCAACAATATAAACTACAAAAGGAAATAGTGGAGGTCTTTGGGTTCTTGAAAATGCACGACTTGTAATAACGATGAGCTCATTGTTATGTTACATCACCACATAATTTCATACAAAGGATCGGGTCTGACAACTTTACAGGACATCTTGAATATTAAGCCAAAAAATTGCTTACCTCTTTGCTGCATCCAACAGGTCACTATCTTTTCTAATCAAATCATTATTTACGAACCACCTTATATCATCAATACCGAACCACACCACGTGCATCTTAGCTCGTCCTAGGAAGCACTAGTAAGAGTCACTTATATCTAGTAGTACAATAGAAAAAGACAGAAACAATCAATTAAAAAATAAAATATACAAAAAAACGAAATGCCTTATATTAACACTATTGACTTTCTAATAGCTAGCTACTGGCAGATACAAACCTTCTAAGATAAAACCATTATTGTAAAACCCAATAAAAAACCCCANNTGGGAAGATACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTAAACTCAAAGTGAAAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837768
dbEST ID: 79655470
Trimmed Sequence: TCCTGTGACTTGGCATCTACCTGTTTGAATATGTGGCAGAACCAAGCTTGGGGCTGGTAGTTCTGGGATGCTCTGGGTGATGAATGTTGAACTGGACTCTTCTGGTTTCTCTTCCAGATTGCTGGTATTAATTTCTTTTTCTTTGATTGATGAGACATCTGCTGGAGGAGAGGGTTTCATCCCAGGACTCTTCCTGCTTTGAAAGCCATTCGTTTTCACAAACAGCAATCTGAGAACCTTTTCTTTCTGCTCCCATGTTAATTCATCAATGTTCATTTTTCCTACCCGTATATCATATACTTTTCCAGCCTCAACTGAACAATTAAGTGAAGTATGTGTTGCTGGTGCCCATATTTAGTAAAATATTTGATCTAGGGATGTGCGTTGTCTGACTATTTTTTACGACGAACGGGTCAGTATCTGTCGCATTAGAGCCACTATATAGAGGCCAGTCCTACAAACGGAAGAGGCTATTTGCGGGCGGGCGACGAGAGAGCGACAGCGTTGTAGAGGTAGAAAAAAAAAAAAGGGGAAAAAAAAGAGGCGTAGACAGGCCAAAAATAGAAAGGGGAGGACAAGCGGTAGAGTGGGCGGAGAAATGAGAGAAGGAGAGAAAGACGAACGGAGGAGGAAAAGGGGGAGGGGGGGGGGAGAAGGGAGAAGAGAGGGGAGGAAGGGGAGAAGGGAGAAAAAGAGAGGGGAAAAAAAAAAAAGAAAAGAGGAGAGAAAAGTGCGAGGGGGCGGGAAAAGGGGGGGGGGGAAGGAAGGGGGAGGGGGGGGAAGGGAGAGAAAGGAGGNANAGAAGAAAAAGGNAAGGGGNNANANGGAAAGGGGAAGAGAAAAAAAAGAAGGGGAGAGAGAGAAGGGAGGAAGAAAGNGNAAGGAGGGGAGAAAGGGGAGGGAAGGGGNGGGCCNNAGGNGAGGGGGGAGANGNGANNGGGGANNAGNAGGAGAGGGGGGCGGGAAAGNGGAGNNAGNNGGGNNNAGAAANNATAAANNGAGAGNNNACGGGGAAGGNNNGGNNGGAAAGGGGAAGGAAAGAAANAAGGANAGNG
Full Trace Sequence: TGCCAGGGAACAGCTACTGACCATGTAATACGACTCACTACTAGGGGAAACCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCTGTGACTTGGCATCTACCTGTTTGAATATGTGGCAGAACCAAGCTTGGGGCTGGTAGTTCTGGGATGCTCTGGGTGATGAATGTTGAACTGGACTCTTCTGGTTTCTCTTCCAGATTGCTGGTATTAATTTCTTTTTCTTTGATTGATGAGACATCTGCTGGAGGAGAGGGTTTCATCCCAGGACTCTTCCTGCTTTGAAAGCCATTCGTTTTCACAAACAGCAATCTGAGAACCTTTTCTTTCTGCTCCCATGTTAATTCATCAATGTTCATTTTTCCTACCCGTATATCATATACTTTTCCAGCCTCAACTGAACAATTAAGTGAAGTATGTGTTGCTGGTGCCCATATTTAGTAAAATATTTGATCTAGGGATGTGCGTTGTCTGACTATTTTTTACGACGAACGGGTCAGTATCTGTCGCATTAGAGCCACTATATAGAGGCCAGTCCTACAAACGGAAGAGGCTATTTGCGGGCGGGCGACGAGAGAGCGACAGCGTTGTAGAGGTAGAAAAAAAAAAAAGGGGAAAAAAAAGAGGCGTAGACAGGCCAAAAATAGAAAGGGGAGGACAAGCGGTAGAGTGGGCGGAGAAATGAGAGAAGGAGAGAAAGACGAACGGAGGAGGAAAAGGGGGAGGGGGGGGGGAGAAGGGAGAAGAGAGGGGAGGAAGGGGAGAAGGGAGAAAAAGAGAGGGGAAAAAAAAAAAAGAAAAGAGGAGAGAAAAGTGCGAGGGGGCGGGAAAAGGGGGGGGGGGAAGGAAGGGGGAGGGGGGGGAAGGGAGAGAAAGGAGGNANAGAAGAAAAAGGNAAGGGGNNANANGGAAAGGGGAAGAGAAAAAAAAGAAGGGGAGAGAGAGAAGGGAGGAAGAAAGNGNAAGGAGGGGAGAAAGGGGAGGGAAGGGGNGGGCCNNAGGNGAGGGGGGAGANGNGANNGGGGANNAGNAGGAGAGGGGGGCGGGAAAGNGGAGNNAGNNGGGNNNAGAAANNATAAANNGAGAGNNNACGGGGAAGGNNNGGNNGGAAAGGGGAAGGAAAGAAANAAGGANAGNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCTGTGACTTGGCATCT