ORFeome > ccdc50 ORF1 – XORFeome v1.0

ccdc50 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccdc50
Gene ID: 984496
Gene Page ID: 984491
ORF Xenbase ID: 17268081

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC070599
Original XGC clone length: 828

Human orthology & disease relationships

NCBI Entrez ID: 152137
Ensembl gene IDs: ENSG00000152492
Directly associated (OMIM) disease MIM numbers: 607453
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11026
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ825167
dbEST ID: 79642869
Trimmed Sequence: ATGACTGAAATCAACATTGATCAGTCTAAGCTACCGGGAGTCAAGGAAGTTTGCAGAGATTTTGCAGTGCTGGAGGATCATACTCTTGCCCACAACCTGCAGGAACAGGAGATCGAGCATCACTTGGCAACGAATATACAGAGGAATCGTTTGGTAAAGAATGATTTACAAGTGGCCAAGCAACTCCAAGAAGAAGAAGAACTCAGAGCACAAGCCCGGAAGAAAAATCATCACAATGAATTGGAAGTTTTAGATTCTGAAATAGCTCAGGAAATTCAAGATAGATTGGTAATTGAAGCAAAACTCAGGCGTCAGCAAGAGGAGAAGGATGAGGACATTGCTCGACTATTACAAGAGAAAGAGGAAAGGAGAAGAAAGAAGCATTACCCACCTACCCAAGAGGAACCTTATTACAAAGACAGAGAAGGGTTTCGACCAAAGGGGGTACAAGATGCACCTATATCTAAACACACAACAGGGTTAAGAAATCAAGAGGAACACGATGCGCACCTTGCCCGGAGGCTTCAGGAAAAAGAATTCAGGGCAAACGTTATGGATAAACGAGCAGCGCAGATGGCTCAGGATGAGGAAATTGCCCGCTATCTTATGGACAAAGAAAAAAAAGCTTATAAGAAGTCAAAAGGACGTTGAAAAATGGACAATGCCTAACGAACTAAAGAAAGTGGAAGCACCTGATCATGGTAGGGCAAGGGACAAGAGAAAGGTCAGGACCCATCATCCACCGTTCCCAAAAATGATTAAACCATAACGGGGCCCCCTTTCCTCCCCCCTTCCCCAATACGCGCTGAAACGAAAAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGAAATCAACATTGATCAGTCTAAGCTACCGGGAGTCAAGGAAGTTTGCAGAGATTTTGCAGTGCTGGAGGATCATACTCTTGCCCACAACCTGCAGGAACAGGAGATCGAGCATCACTTGGCAACGAATATACAGAGGAATCGTTTGGTAAAGAATGATTTACAAGTGGCCAAGCAACTCCAAGAAGAAGAAGAACTCAGAGCACAAGCCCGGAAGAAAAATCATCACAATGAATTGGAAGTTTTAGATTCTGAAATAGCTCAGGAAATTCAAGATAGATTGGTAATTGAAGCAAAACTCAGGCGTCAGCAAGAGGAGAAGGATGAGGACATTGCTCGACTATTACAAGAGAAAGAGGAAAGGAGAAGAAAGAAGCATTACCCACCTACCCAAGAGGAACCTTATTACAAAGACAGAGAAGGGTTTCGACCAAAGGGGGTACAAGATGCACCTATATCTAAACACACAACAGGGTTAAGAAATCAAGAGGAACACGATGCGCACCTTGCCCGGAGGCTTCAGGAAAAAGAATTCAGGGCAAACGTTATGGATAAACGAGCAGCGCAGATGGCTCAGGATGAGGAAATTGCCCGCTATCTTATGGACAAAGAAAAAAAAGCTTATAAGAAGTCAAAAGGACGTTGAAAAATGGACAATGCCTAACGAACTAAAGAAAGTGGAAGCACCTGATCATGGTAGGGCAAGGGACAAGAGAAAGGTCAGGACCCATCATCCACCGTTCCCAAAAATGATTAAACCATAACGGGGCCCCCTTTCCTCCCCCCTTCCCCAATACGCGCTGAAACGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGAAATCAACATTGATCAG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGTATAATCATCATCGTAATCATCATCGTCAGCAGTATCTGGAGGTGGAGGAAGGGGCCTGTATGGTTTATCACTTCTGGAACGGTGATGATGGTCCTGACCTTCTCTTGTCCTTTGCCTAACATGATCAGGTGCCTCCAATTCTTCTAGTCGCTTAGCATCTGTCATTTTTTCACGTCCTTTTGACTTCTTATAAGCTTTTTCTTCTTTGTCCGTAAGATAGCGGGCAATTTCCTCATCCTGAGCCATCTGCGCTGCTCGTTTATCCATAACGTTTGCCCGGAATTCTTTTTCCTGAAGCCTCCGGGCAAGGTGCGCGTCGTGTTCCTCTTGATTTCTTAACCCTGTTGTGTGTTTAGATATAGGTGCATCGTGTACCCCCTTTGGTCGAAACCCTTCTCTGTCTTTGTAATAAGGTTCCGCGTGGGTAGGGGGGTGGTGCTTCGTGCTTCTCCTTTCCTCTTTCTCTTGTAATAATGAAGCAATGTCCTGATGCTTCTCCTCTTCCTGGAGCCGGAATTGGGCTTGGTTTACAATCTGTCTTGAATTTCCGGAACTATTTCAGAATCTAAAACTTCAATTTCTTGGGATGGGGTTGCTTCTGGGCTTGGGGGCGGGGGGGGTGGTGGGGCTGAAATTGGTGGGGGGGTGGGAGGAGGGTCGGTGGCCAACCATTCCGCCAAAAACTTCGTTCCCAATTAATCCCGGGAGGCCGGTTCCGCGGGGTGTTGGGGGGCGGAGGGGGGAGAGGCCGGGGGAGAAGGAAAGAGACCCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGTATAATCATCATCGTAATC