ORFeome > ccdc69 ORF2 – XORFeome v1.0

ccdc69 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccdc69
Gene ID: 6252750
Gene Page ID: 999146
ORF Xenbase ID: 17268135

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124990
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ837555
dbEST ID: 79655257
Trimmed Sequence: ATGGGCTCCAAAACCAGTAAAATGTGCTGCCCCCAACTCAGGAAGAAGAAGCGGCAAAAAGCACATAAAGAAGGGCCGTCATCTCAGGAGCTGAATGACTTAAATGCCAAGAGTCAAGGACCTAATGAGCTGCTACAGAAGATCAAGGAATATGAGCAGGAGATTAGAAACATCCTTCAGAAACACCAAGAGGAGAAGACTGCTCTGGCAGATGCCCACAAAGCTGATGTGGAAGCCCGAACACTGGTGTTACAAGCACAGGCCCAGAAAGATAGAGATGCTGAAACGGTAAAGCTCCTTTCAGAGCAGGCGGCCACCATGAAAGCAGAGATGGAGGAGATGTTTGCAGAGCTGCAAAAGTCTTATGAGCAGGAGAAGTCGTCTCTCACAGAAATTCACCAGCAATTAACAGATGCACTACAGGAAAGCGTGGATGAGTTAAATTCCCAGCTGGCTTCTTTTCGAGAGAAAATGAAGAGGGTGGAAGAATCTATCTTGAGCCAAGACTACCAGAGGCACATTCAGGATTATGGAAGCCCGGGCCAGTTCTGGGAAAAAGAGCTCCAAAGCTTGCACTTCGTTATTGAAATGAAAAGCGAGTTAATACGGGAGCAGGACNAGCGTCTTCAAAGGCACAAATCTACAATGGAGAGAAGTCTGGAGCTTGAGGGAGAGAAGCCGGACACTGCAGCAGGAAAATAAACCCCTGAAAAGTTCAAACACAAAAAACAAGGGGGCCATCACTGGTGCCGTTTATCCTGAGGGAACCTGCTTAAGCATCCCCAACCCACCCCCAAAAAAAAACCAAAAACCCAT
Full Trace Sequence: GGGGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCTCCAAAACCAGTAAAATGTGCTGCCCCCAACTCAGGAAGAAGAAGCGGCAAAAAGCACATAAAGAAGGGCCGTCATCTCAGGAGCTGAATGACTTAAATGCCAAGAGTCAAGGACCTAATGAGCTGCTACAGAAGATCAAGGAATATGAGCAGGAGATTAGAAACATCCTTCAGAAACACCAAGAGGAGAAGACTGCTCTGGCAGATGCCCACAAAGCTGATGTGGAAGCCCGAACACTGGTGTTACAAGCACAGGCCCAGAAAGATAGAGATGCTGAAACGGTAAAGCTCCTTTCAGAGCAGGCGGCCACCATGAAAGCAGAGATGGAGGAGATGTTTGCAGAGCTGCAAAAGTCTTATGAGCAGGAGAAGTCGTCTCTCACAGAAATTCACCAGCAATTAACAGATGCACTACAGGAAAGCGTGGATGAGTTAAATTCCCAGCTGGCTTCTTTTCGAGAGAAAATGAAGAGGGTGGAAGAATCTATCTTGAGCCAAGACTACCAGAGGCACATTCAGGATTATGGAAGCCCGGGCCAGTTCTGGGAAAAAGAGCTCCAAAGCTTGCACTTCGTTATTGAAATGAAAAGCGAGTTAATACGGGAGCAGGACNAGCGTCTTCAAAGGCACAAATCTACAATGGAGAGAAGTCTGGAGCTTGAGGGAGAGAAGCCGGACACTGCAGCAGGAAAATAAACCCCTGAAAAGTTCAAACACAAAAAACAAGGGGGCCATCACTGGTGCCGTTTATCCTGAGGGAACCTGCTTAAGCATCCCCAACCCACCCCCAAAAAAAAACCAAAAACCCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCTCCAAAACCAGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837554
dbEST ID: 79655256
Trimmed Sequence: CGGGCAGCTCCTGTGCAGAGAGAACTGCTGAGTGATGTCGCCAATTACGGCTCGGTATAGATTCTGTTCCTTCTCCCTTTCCAGTTGTTCACAGCGATGGGTCTGCTTCTCTAGGGTGGTTTGGATGCTTAGCAGCTCCTCAGATAAACGCACAGTGATGGCCCCTTGCTTCTGTGTTTGAACTTTCAAGGCTTCATTTTCCTGCTGCAGTGTCCGGCTTCTCTCCTCAAGCTCCAGACTTCTCTCCATTGTAGATTTGTGCCTTTGAAGACGCTTGTCCTGCTCCCGTATTAACTCGCTTTTCATTTCAATAACGAAGTGCAAGCTTTGGAGCTCTTTTTCCCAGAACTGGCCCGGGCTTCCATAATCCTGAATGTGCCTCTGGTAGTCTTGGCTCAAGATAGATTCTTCCACCCTCTTCATTTTCTCTCGAAGAGAAGCCAGCTGGGAGTTTAACTCATCCACGCTTTCCTGTAGTGCATCGGTTAATTGCTGGTGAATTTCTATGAGAGACGACTTCTCCTGCTCATAAGAATTTTGCAGCTCTGGCAACCTCTCCCCCCTCTCTGCTTTCATGGTGGCCGCCTGCTCTGAAGGGACTTTAGCGGTTCCGCATCGCCGTCTTTTTGGTCCTGGGGGTGGGAAGGGGGGGATTCGGGCTTGGGCAGCGACTTTGGGGGGGTTCGGGGGAGGGGGTCGTACCCACCGTTGGGGTTCCCGGGAAGGGAGGTTGCCAAAGGGGGGGGGGCCCCATATCCCTTTTGA
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGGGCAGCTCCTGTGCAGAGAGAACTGCTGAGTGATGTCGCCAATTACGGCTCGGTATAGATTCTGTTCCTTCTCCCTTTCCAGTTGTTCACAGCGATGGGTCTGCTTCTCTAGGGTGGTTTGGATGCTTAGCAGCTCCTCAGATAAACGCACAGTGATGGCCCCTTGCTTCTGTGTTTGAACTTTCAAGGCTTCATTTTCCTGCTGCAGTGTCCGGCTTCTCTCCTCAAGCTCCAGACTTCTCTCCATTGTAGATTTGTGCCTTTGAAGACGCTTGTCCTGCTCCCGTATTAACTCGCTTTTCATTTCAATAACGAAGTGCAAGCTTTGGAGCTCTTTTTCCCAGAACTGGCCCGGGCTTCCATAATCCTGAATGTGCCTCTGGTAGTCTTGGCTCAAGATAGATTCTTCCACCCTCTTCATTTTCTCTCGAAGAGAAGCCAGCTGGGAGTTTAACTCATCCACGCTTTCCTGTAGTGCATCGGTTAATTGCTGGTGAATTTCTATGAGAGACGACTTCTCCTGCTCATAAGAATTTTGCAGCTCTGGCAACCTCTCCCCCCTCTCTGCTTTCATGGTGGCCGCCTGCTCTGAAGGGACTTTAGCGGTTCCGCATCGCCGTCTTTTTGGTCCTGGGGGTGGGAAGGGGGGGATTCGGGCTTGGGCAGCGACTTTGGGGGGGTTCGGGGGAGGGGGTCGTACCCACCGTTGGGGTTCCCGGGAAGGGAGGTTGCCAAAGGGGGGGGGGCCCCATATCCCTTTTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGCAGCTCCTGTGCAGA