ORFeome > ccnb3 ORF1 – XORFeome v1.0

ccnb3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccnb3
Gene ID: 920224
Gene Page ID: 920212
ORF Xenbase ID: 17268219

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041181
Original XGC clone length: 1251

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ823725
dbEST ID: 79641427
Trimmed Sequence: ATGATGCCTTCTCTTCGTCCATCTCGGCCAGTGGCTTCCAAACTTCCGAAACTGGGGAAGCCGGTTACTGCAGAGAATAATCGACTTGATAAGGTGGAGATCAGTCAGACAAAGCGTTCTCCTTCCTCTCCACAGGGAGGCGCAAAGAAGAGAGCAGCATTTGGAGACATTACCAATGCTCACAAAAACCCACAACTAATTCAGAAGAAGAAGGAGGGACAGAAAGTTGCCATCAAGAAGACCAAAAGTGCTCCCACAAGTGACATTACAAAGAATAATGAGCTCAATATCAAGAAGACTCAGAAGAAGGCCACAGTAACTGAAGAACATCTCCCTGAAGTAAAAGAAGAAAAAATAAACACTGAGCAGAAAACATCAGTACCTACCAAGGAAATACCTGAGGAAAAGGTTCTTCCACCTGGTGTTGAGGACATAGACCAGGACTCTCTTGACGACCCCTTCTCTAACTCTGAATATGCAACGGATATTTTCAGCTATATGCGGGACAGAGAGGAGAAATTTCTGCTTCCAAACTACCTGGAGATGCAAACAGATATTAGCAAGGATATGAGGGCTATCCTTGTGGATTGGATGGTGGAGGTGCAGGAAAACTTTGAGCTTAACCATGAAACCCTATACCTGGCAGTGAAAATGGTCGACCATTATTTAGCAGTGTCTGTCGTCATGAANGAGAAGCTTCAGCTTATTGGTTCCACTGCTGTACTCATTGCATCTAAG
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGCCTTCTCTTCGTCCATCTCGGCCAGTGGCTTCCAAACTTCCGAAACTGGGGAAGCCGGTTACTGCAGAGAATAATCGACTTGATAAGGTGGAGATCAGTCAGACAAAGCGTTCTCCTTCCTCTCCACAGGGAGGCGCAAAGAAGAGAGCAGCATTTGGAGACATTACCAATGCTCACAAAAACCCACAACTAATTCAGAAGAAGAAGGAGGGACAGAAAGTTGCCATCAAGAAGACCAAAAGTGCTCCCACAAGTGACATTACAAAGAATAATGAGCTCAATATCAAGAAGACTCAGAAGAAGGCCACAGTAACTGAAGAACATCTCCCTGAAGTAAAAGAAGAAAAAATAAACACTGAGCAGAAAACATCAGTACCTACCAAGGAAATACCTGAGGAAAAGGTTCTTCCACCTGGTGTTGAGGACATAGACCAGGACTCTCTTGACGACCCCTTCTCTAACTCTGAATATGCAACGGATATTTTCAGCTATATGCGGGACAGAGAGGAGAAATTTCTGCTTCCAAACTACCTGGAGATGCAAACAGATATTAGCAAGGATATGAGGGCTATCCTTGTGGATTGGATGGTGGAGGTGCAGGAAAACTTTGAGCTTAACCATGAAACCCTATACCTGGCAGTGAAAATGGTCGACCATTATTTAGCAGTGTCTGTCGTCATGAANGAGAAGCTTCAGCTTATTGGTTCCACTGCTGTACTCATTGCATCTAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCCTTCTCTTCGTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829034
dbEST ID: 79646736
Trimmed Sequence: GCTCTGAAGGGCCTCTGTAAGTGTTAGCATGTCCATGGGGGGCAATTTTGCCACTTCAAAGAAGACCCTGTGTGAGTATTTGCTCCTCACTGCCTTTAACTTCTTGTTGGGAGGATATGTGAGTAGGAAATTCAGCCTCTTCACTAGGGGCAATAAATCATTGGTCTGATACCCACTGTAATAATGTAGTGTGGCAGTCCATCTGCCCAACCCCTTCATTTGAAGAGCAAGCAACAGGCAGTTGGCAGCCATCTTAGATGCACGCTCCTGCACAAAGTCATATTCCTGTAGGGTCAGTTCACAAATGTATCTGGCAAGGGTCAGAGTCTCCATGGTGGCATGGGCACACTTAGCAAATCTGCGCAGGAAGCGGTATGGGACCGGAATGTTGATGTCAAAGTAGAGTTTTTGCAGGATTTCCATCTCCATAGCAATAACCTCATCCCTTTTGTATGCATCATCACAGATGTACATGAAATCGTCGACACAGGGTGGGCAACGCTCCTCGAACTTAGATGCAATGAGTACAGCAGTGGAACCAATAAGCTGAAGCTTCTCCTTCATGACGACAGACACTGCTAAATAATGGTCGACCATTTTCACTGCCANGTATAGGGTTTCATGGTTAAGCTCAAAGTTTTCCTGCACCTCCACCATCCAATCCACAAGGATAGCCCCTCATATCCTTTGCTAATATCTGTTTTGCCATCCTCAGGGTAATTTTGGAAACCCGAAAAATTTTT
Full Trace Sequence: GGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTCTGAAGGGCCTCTGTAAGTGTTAGCATGTCCATGGGGGGCAATTTTGCCACTTCAAAGAAGACCCTGTGTGAGTATTTGCTCCTCACTGCCTTTAACTTCTTGTTGGGAGGATATGTGAGTAGGAAATTCAGCCTCTTCACTAGGGGCAATAAATCATTGGTCTGATACCCACTGTAATAATGTAGTGTGGCAGTCCATCTGCCCAACCCCTTCATTTGAAGAGCAAGCAACAGGCAGTTGGCAGCCATCTTAGATGCACGCTCCTGCACAAAGTCATATTCCTGTAGGGTCAGTTCACAAATGTATCTGGCAAGGGTCAGAGTCTCCATGGTGGCATGGGCACACTTAGCAAATCTGCGCAGGAAGCGGTATGGGACCGGAATGTTGATGTCAAAGTAGAGTTTTTGCAGGATTTCCATCTCCATAGCAATAACCTCATCCCTTTTGTATGCATCATCACAGATGTACATGAAATCGTCGACACAGGGTGGGCAACGCTCCTCGAACTTAGATGCAATGAGTACAGCAGTGGAACCAATAAGCTGAAGCTTCTCCTTCATGACGACAGACACTGCTAAATAATGGTCGACCATTTTCACTGCCANGTATAGGGTTTCATGGTTAAGCTCAAAGTTTTCCTGCACCTCCACCATCCAATCCACAAGGATAGCCCCTCATATCCTTTGCTAATATCTGTTTTGCCATCCTCAGGGTAATTTTGGAAACCCGAAAAATTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCTGAAGGGCCTCTGT