ORFeome > ccnc ORF1 – XORFeome v1.0

ccnc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccnc
Gene ID: 922018
Gene Page ID: 922005
ORF Xenbase ID: 17268231

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099287
Original XGC clone length: 852

Human orthology & disease relationships

NCBI Entrez ID: 892
Ensembl gene IDs: ENSG00000112237
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11006
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ840130
dbEST ID: 79657832
Trimmed Sequence: ATGGCGGGGAACTTTTGGCAGAGCTCTCACTATTTGCAATGGATTTTGGACAAACAAGACCTATTAAAAGAACGACAAAAAGACCTGAAATTTCTAAGTGAAGAAGAATATTGGAAATTGCAGATATTTTTTACAAATGTTATCCAAGCTTTAGGAGAACACCTTAAATTACGACAACAAGTCATTGCCACTGCGACTGTTTATTTTAAAAGATTTTATGCAAGGTATTCTTTAAAAAGTATAGATCCTGTTTTAATGGCACCAACATGTGTGTTTTTGGCATCCAAAGTAGAGGAATTTGGTGTTGTTTCAAACACAAGATTAATCTCTGCTGCTACTTCTGTGTTAAAAACTAGGTTTTCATATGCATTTCCAAAGGAATTTCCTTACAGGATGAACCATATATTGGAATGTGAATTCTACCTATTAGAATTAATGGATTGCTGCTTGATAGTATATCATCCCTATAGACCCTTGCTTCAGTATGTGCAGGACATGGGACAGGAGGATATGCTACTTCCACTAGCATGGAGGATAGTAAATGATACATACCGTACAGATCTATGCTTGCTATACCCACCGTTCATGATTGCTCTTGCTTGCCTGCATGTAGCATGTGTTGTTCAGCAGAAGGATGCACGCCAGTGGTTTGCTGAACTATCTGTGGATATGGAAAAGAATTTGGGAAATAATTCCAAGTTATCCTAAAACTATATTAACCGTTGGAAAAAATTTTGA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAACTTTTGGCAGAGCTCTCACTATTTGCAATGGATTTTGGACAAACAAGACCTATTAAAAGAACGACAAAAAGACCTGAAATTTCTAAGTGAAGAAGAATATTGGAAATTGCAGATATTTTTTACAAATGTTATCCAAGCTTTAGGAGAACACCTTAAATTACGACAACAAGTCATTGCCACTGCGACTGTTTATTTTAAAAGATTTTATGCAAGGTATTCTTTAAAAAGTATAGATCCTGTTTTAATGGCACCAACATGTGTGTTTTTGGCATCCAAAGTAGAGGAATTTGGTGTTGTTTCAAACACAAGATTAATCTCTGCTGCTACTTCTGTGTTAAAAACTAGGTTTTCATATGCATTTCCAAAGGAATTTCCTTACAGGATGAACCATATATTGGAATGTGAATTCTACCTATTAGAATTAATGGATTGCTGCTTGATAGTATATCATCCCTATAGACCCTTGCTTCAGTATGTGCAGGACATGGGACAGGAGGATATGCTACTTCCACTAGCATGGAGGATAGTAAATGATACATACCGTACAGATCTATGCTTGCTATACCCACCGTTCATGATTGCTCTTGCTTGCCTGCATGTAGCATGTGTTGTTCAGCAGAAGGATGCACGCCAGTGGTTTGCTGAACTATCTGTGGATATGGAAAAGAATTTGGGAAATAATTCCAAGTTATCCTAAAACTATATTAACCGTTGGAAAAAATTTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAACTTTTGGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840129
dbEST ID: 79657831
Trimmed Sequence: AGACTGACTGTACCCAGAGCTTTGGCTTCCATTTGTTCCTTGCTCACCGTCACTGTTAGGGGGAGGCTTGGGTTTCGGCATTTTACTAAGAATAGAAGCCATTTCCTTTCGCTCATCAAAATTCTTCCACTGTTCATATAGTTTTAGGATAACTCGAATTATTTCCAAAATCTTTTCCATATCCACAGATAGTTCAGCAAACCACTGGCGTGCATCCTTCTGCTGAACAACACATGCTACATGCAGGCAAGCAAGAGCAATCATGAACGGTGGGTATAGCAAGCATAGATCTGTACGGTATGTATCATTTACTATCCTCCATGCTAGTGGAAGTAGCATATCCTCCTGTCCCATGTCCTGCACATACTGAAGCAAGGGTCTATAGGGATGATATACTATCAAGCAGCAATCCATTAATTCTAATAGGTAGAATTCACATTCCAATATATGGTTCATCCTGTAAGGAAATTCCTTTGGAAATGCATATGAAAACCTAGTTTTTAACACAGAAGTAGCAGCAGAGATTAATCTTGTGTTTGAAACAACACCAAATTCCTCTACTTTGGATGCCAAAAACACACATGTTGGTGCCATTAAAACAGGATCTATACTTTTTAAAGAATACCTTGCATAAAATCTTTTAAAATAACCAGTCGCAGTGGCCAATGACTTGTTGTCCTAAATTTAGGGTGTTCTCCCTAAGGCTTGGGATAACAATTTTGTAAAAAAAAATCTTTC
Full Trace Sequence: GGGAAAATGCTATAGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACTGACTGTACCCAGAGCTTTGGCTTCCATTTGTTCCTTGCTCACCGTCACTGTTAGGGGGAGGCTTGGGTTTCGGCATTTTACTAAGAATAGAAGCCATTTCCTTTCGCTCATCAAAATTCTTCCACTGTTCATATAGTTTTAGGATAACTCGAATTATTTCCAAAATCTTTTCCATATCCACAGATAGTTCAGCAAACCACTGGCGTGCATCCTTCTGCTGAACAACACATGCTACATGCAGGCAAGCAAGAGCAATCATGAACGGTGGGTATAGCAAGCATAGATCTGTACGGTATGTATCATTTACTATCCTCCATGCTAGTGGAAGTAGCATATCCTCCTGTCCCATGTCCTGCACATACTGAAGCAAGGGTCTATAGGGATGATATACTATCAAGCAGCAATCCATTAATTCTAATAGGTAGAATTCACATTCCAATATATGGTTCATCCTGTAAGGAAATTCCTTTGGAAATGCATATGAAAACCTAGTTTTTAACACAGAAGTAGCAGCAGAGATTAATCTTGTGTTTGAAACAACACCAAATTCCTCTACTTTGGATGCCAAAAACACACATGTTGGTGCCATTAAAACAGGATCTATACTTTTTAAAGAATACCTTGCATAAAATCTTTTAAAATAACCAGTCGCAGTGGCCAATGACTTGTTGTCCTAAATTTAGGGTGTTCTCCCTAAGGCTTGGGATAACAATTTTGTAAAAAAAAATCTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTGACTGTACCCAGA