ORFeome > ccnd2 ORF1 – XORFeome v1.0

ccnd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccnd2
Gene ID: 865455
Gene Page ID: 481218
ORF Xenbase ID: 17268255

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106703
Original XGC clone length: 876

Human orthology & disease relationships

NCBI Entrez ID: 894
Ensembl gene IDs: ENSG00000118971
Directly associated (OMIM) disease MIM numbers: 615938
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,125853,132600,155255,259500,275355,601859,609048,609446

Library Location

Plate ID: GDExl11083
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ837194
dbEST ID: 79654896
Trimmed Sequence: ATGGAACTGCTGTGCTGCGAGGGGGACACTGTCCGCAGGGCTCAGCTTGACCCCGCGCTGCTGCTGGATGACAGGGTCCTGCACAATCTGCTCACCGTGGAGGAGAGGTACCTGCCCCACTGCTCCTACTTCAAATGTGTCCAGAAGGACATCCAGCCCTTCATGAGGAGGATGGTGGCCACTTGGATGCTGGAGGTCTGTGAAGAACAGAGGTGCGAGGAAGAAGTGTTCCCCCTGGCCATGAATTACTTGGATAGATTTTTAGCTGTGATCCCAACAAGAAAGAGCCATTTACAACTCCTCGGGGCCGTCTGCATGTTCTTAGCTTCCAAGCTGAAAGAGACTATCCCTTTAACCGCAGAGAAACTTTGCATTTATACTGACAATTCTATCAAACCGCAAGAGCTGCTGGAGTGGGAGCTGGTGGTTCTGGGAAAGTTGAAGTGGAACCTGGCTGCGGTGACGCCACATGATTTCATAGAACACATACTAAGAAAATTGCCCTTGCCAAAAGACAAATTGCTCTTGATCCGGAAACATGCACAAACGTTCATTGCACTTTGTGCCACAGACTTAAACTTTGCCATGTACCCGCCATCTATGATAGCAACTGGAAGTGTAGGAGCAGCGATATGTGGGGCTGGAGTTTGGATGATGGGAGAGACCTCACTTTTCTGTCAATATTCTCCCAAAACCATTTTGGCCAAGAATCCCTACCACAAAAGTTGGATTTGCCTTTAAAGCTTGTTAAAAAACAAAAAGCAGTTCAGTTCATGGTTAAAAACCCTTCAAACAACAAACAAAAGCAAACAAG
Full Trace Sequence: TCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACTGCTGTGCTGCGAGGGGGACACTGTCCGCAGGGCTCAGCTTGACCCCGCGCTGCTGCTGGATGACAGGGTCCTGCACAATCTGCTCACCGTGGAGGAGAGGTACCTGCCCCACTGCTCCTACTTCAAATGTGTCCAGAAGGACATCCAGCCCTTCATGAGGAGGATGGTGGCCACTTGGATGCTGGAGGTCTGTGAAGAACAGAGGTGCGAGGAAGAAGTGTTCCCCCTGGCCATGAATTACTTGGATAGATTTTTAGCTGTGATCCCAACAAGAAAGAGCCATTTACAACTCCTCGGGGCCGTCTGCATGTTCTTAGCTTCCAAGCTGAAAGAGACTATCCCTTTAACCGCAGAGAAACTTTGCATTTATACTGACAATTCTATCAAACCGCAAGAGCTGCTGGAGTGGGAGCTGGTGGTTCTGGGAAAGTTGAAGTGGAACCTGGCTGCGGTGACGCCACATGATTTCATAGAACACATACTAAGAAAATTGCCCTTGCCAAAAGACAAATTGCTCTTGATCCGGAAACATGCACAAACGTTCATTGCACTTTGTGCCACAGACTTAAACTTTGCCATGTACCCGCCATCTATGATAGCAACTGGAAGTGTAGGAGCAGCGATATGTGGGGCTGGAGTTTGGATGATGGGAGAGACCTCACTTTTCTGTCAATATTCTCCCAAAACCATTTTGGCCAAGAATCCCTACCACAAAAGTTGGATTTGCCTTTAAAGCTTGTTAAAAAACAAAAAGCAGTTCAGTTCATGGTTAAAAACCCTTCAAACAACAAACAAAAGCAAACAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACTGCTGTGCTGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837193
dbEST ID: 79654895
Trimmed Sequence: CAGGTTGATGTCCTGCACATCTGTAGGAGTGCTAGCCTGGTCCAGTTCATCCACGGACTTGGACGAGTTTCTTTGCTGTGCCTGTTGCCTCGTCTGTCTGAGGCTTCTCACCAGCACCGACTCGATCTGCTCCTGACAAGCTTTAAGGCAATCCACATCTGTGCTAGTGATCTTGGCCAAATGCTCTGTGAGACTATCGCCAGAAAGAGAGGTTTCTCCATCATCCAACTGCAGCCCACATATCGCTGCTCCTACACTTCCAGTTGCTATCATAGATGGCGGGTACATTGCAAAGTTAAAGTCTGTGGCACAAAGTGCAATGAACGTTTGTGCATGTTTCCGGATCAAGAGCAATTTGTCTTTTGGCAAGGGCAATTTTCTTAGTATGTGTTCTATGAAATCATGTGGCGTCACCGCAACCAGGTTCCACTTCAACTTTCCCAAAACCACCACCTCCCCCTCCCGCAGCTCTTGCGGTTGGATAGAATTGTCATTATAAATGCAAAGTTTCTCTGCGGGTGAGGGGGATAGTCTCTTTCCCCTTGGAAGCTAAGAAACATGCAAACGGGCCCAAGGGATTGGTAAATGGCTCTTTCTTGTTGGTGAGGACGGGCGAAAAATCTATTCCAACTCATTTCTTGGGTCAGGGGGGGGCGCTTGCGGCGTCCGCCCGTCCATTTACTTCGGGGAG
Full Trace Sequence: GGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGTTGATGTCCTGCACATCTGTAGGAGTGCTAGCCTGGTCCAGTTCATCCACGGACTTGGACGAGTTTCTTTGCTGTGCCTGTTGCCTCGTCTGTCTGAGGCTTCTCACCAGCACCGACTCGATCTGCTCCTGACAAGCTTTAAGGCAATCCACATCTGTGCTAGTGATCTTGGCCAAATGCTCTGTGAGACTATCGCCAGAAAGAGAGGTTTCTCCATCATCCAACTGCAGCCCACATATCGCTGCTCCTACACTTCCAGTTGCTATCATAGATGGCGGGTACATTGCAAAGTTAAAGTCTGTGGCACAAAGTGCAATGAACGTTTGTGCATGTTTCCGGATCAAGAGCAATTTGTCTTTTGGCAAGGGCAATTTTCTTAGTATGTGTTCTATGAAATCATGTGGCGTCACCGCAACCAGGTTCCACTTCAACTTTCCCAAAACCACCACCTCCCCCTCCCGCAGCTCTTGCGGTTGGATAGAATTGTCATTATAAATGCAAAGTTTCTCTGCGGGTGAGGGGGATAGTCTCTTTCCCCTTGGAAGCTAAGAAACATGCAAACGGGCCCAAGGGATTGGTAAATGGCTCTTTCTTGTTGGTGAGGACGGGCGAAAAATCTATTCCAACTCATTTCTTGGGTCAGGGGGGGGCGCTTGCGGCGTCCGCCCGTCCATTTACTTCGGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTTGATGTCCTGCAC