ORFeome > ccne2 ORF1 – XORFeome v1.0

ccne2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccne2
Gene ID: 923055
Gene Page ID: 923042
ORF Xenbase ID: 17268273

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043855
Original XGC clone length: 1194

Human orthology & disease relationships

NCBI Entrez ID: 9134
Ensembl gene IDs: ENSG00000175305
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,133780,158350,168600,261550,605909

Library Location

Plate ID: GDExl11010
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ823841
dbEST ID: 79641543
Trimmed Sequence: ATGTCAAGAAGAAGTGGCCGTCTACAAGCAAGGCATGGAAGCGCTGAGACTGGGAACGACTGCCAACTTGCAGTTGCAACAAAGAAACGCAAATCTGAGGAAACTAGCACAACATTTGAATGCCACCAGGACGCAAAACGACACAACTATGAAATCCAGGGCTGCTGGTCAGAGATCACTACAGGAACAGTGACTCCTTGTATTCTCATAGAAACGCCACACAAAGAAATGCCAGTCTCCACCGACCTATCACAGTTCTCCCGATACAGGTTCAAGAATCTCTTCATCAGCCGATCCCCTCTGCCAGAGCTAAGCTGGGGCAATTCAAAGGATGTGTGGATGAAGATGATAAGCAAAGAGTCGAGATATGTGCATTCTAGCCGTCTTCTACAAAATCATCCCACGTTGAACCCAGACATGAGGTCTATTCTGCTGGACTGGCTCATAGAGGTATCCGAGGTCTACACGCTACACAGAGAAACCTTTTACCTAGCCCAGGATTTCTTTGATAGATTTATGCTGACCCAAACCTGTGTGAACAAAAGTATGCTTCAGCTTATAGGAGTTACGGCACTATTTATTGCTTCTAAATTAGAGGAGATCTACCCGCCAAAACTTTATGAATTTGCATACGTCACCGATGGTGCCTGCACTGAAGATGATATTCTTCAAATGGAGCTCATAATATTAAAGGCTTTGAAGTGGGAATTGTGTCCTGGTACTGCCATTTCATGGCTGAACCTGTACCTGCAAGTGTCTTCTCTTAAAGATCATCCCAAACTGCTTGTTTACTTCATTAATTCTCAGGGAACCAATTTTATTTCAGGTT
Full Trace Sequence: AATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAAGAAGAAGTGGCCGTCTACAAGCAAGGCATGGAAGCGCTGAGACTGGGAACGACTGCCAACTTGCAGTTGCAACAAAGAAACGCAAATCTGAGGAAACTAGCACAACATTTGAATGCCACCAGGACGCAAAACGACACAACTATGAAATCCAGGGCTGCTGGTCAGAGATCACTACAGGAACAGTGACTCCTTGTATTCTCATAGAAACGCCACACAAAGAAATGCCAGTCTCCACCGACCTATCACAGTTCTCCCGATACAGGTTCAAGAATCTCTTCATCAGCCGATCCCCTCTGCCAGAGCTAAGCTGGGGCAATTCAAAGGATGTGTGGATGAAGATGATAAGCAAAGAGTCGAGATATGTGCATTCTAGCCGTCTTCTACAAAATCATCCCACGTTGAACCCAGACATGAGGTCTATTCTGCTGGACTGGCTCATAGAGGTATCCGAGGTCTACACGCTACACAGAGAAACCTTTTACCTAGCCCAGGATTTCTTTGATAGATTTATGCTGACCCAAACCTGTGTGAACAAAAGTATGCTTCAGCTTATAGGAGTTACGGCACTATTTATTGCTTCTAAATTAGAGGAGATCTACCCGCCAAAACTTTATGAATTTGCATACGTCACCGATGGTGCCTGCACTGAAGATGATATTCTTCAAATGGAGCTCATAATATTAAAGGCTTTGAAGTGGGAATTGTGTCCTGGTACTGCCATTTCATGGCTGAACCTGTACCTGCAAGTGTCTTCTCTTAAAGATCATCCCAAACTGCTTGTTTACTTCATTAATTCTCAGGGAACCAATTTTATTTCAGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAGAAGAAGTGGCCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829149
dbEST ID: 79646851
Trimmed Sequence: GAAAGTCTTTTCCGTACTCTTGGGAGGGGTGAGGATACCACCAATGAACACAGGAGACTCACCCAAAACACGATCTGGAATCTTTACATCATCCAGCATATCAATGTAGTTGGTGTGGGTCTGGATATTGTGCATATCTTCTGGTGATATCCTCTTAAACACTTTCAGCTTTAATGGGAAACTTTTCTTCACAACACTCGCAAAAGGAGTCATCCAATGAACACATTCACTGATGCTGTCCATGTCGAGACCAGTAGCTTTGGTAACAACTTCTATGGAGGTACAGTGGTATAAAGCAGCAGCCGCCAAGATCCTGTACTGGAATTCAAGCGAGGTATGGTGTAGAATACACATGTCTAGAAGCTGAGCAACATGAATAAACTGCTCCTGAGAATACTGAGGTAACAGCAGTTTTGGATGATCTTTAAGAGAAGACACTTGCAGGTACAGGTTCAGCCATGAAATGGCAGTTACAGGACACAATTCCCACTTCAAAGCCTTTAATATTATGAGCTCCATTTGAAGAATATCATCTTCAGTGCAGGCACCATCGGTGACGTATGCAAATTCATAAAGTTTTGGCGGGTAGATCTCCTCTAATTTAGAAGCAATAAATAGTGCCGTAACTCCTATAAGCTGAAGCATACTTTTGTTCACACAGGGTTTGGGTCAGCATAAATCTATCAAAGAAATCCCTGGGGCTAGGTAAAAGGGTTTCCTCTGGTGTAAGCGGTGTAAAACCTCCGGAATACCCTCCTATTAAGCCC
Full Trace Sequence: GGCCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAGTCTTTTCCGTACTCTTGGGAGGGGTGAGGATACCACCAATGAACACAGGAGACTCACCCAAAACACGATCTGGAATCTTTACATCATCCAGCATATCAATGTAGTTGGTGTGGGTCTGGATATTGTGCATATCTTCTGGTGATATCCTCTTAAACACTTTCAGCTTTAATGGGAAACTTTTCTTCACAACACTCGCAAAAGGAGTCATCCAATGAACACATTCACTGATGCTGTCCATGTCGAGACCAGTAGCTTTGGTAACAACTTCTATGGAGGTACAGTGGTATAAAGCAGCAGCCGCCAAGATCCTGTACTGGAATTCAAGCGAGGTATGGTGTAGAATACACATGTCTAGAAGCTGAGCAACATGAATAAACTGCTCCTGAGAATACTGAGGTAACAGCAGTTTTGGATGATCTTTAAGAGAAGACACTTGCAGGTACAGGTTCAGCCATGAAATGGCAGTTACAGGACACAATTCCCACTTCAAAGCCTTTAATATTATGAGCTCCATTTGAAGAATATCATCTTCAGTGCAGGCACCATCGGTGACGTATGCAAATTCATAAAGTTTTGGCGGGTAGATCTCCTCTAATTTAGAAGCAATAAATAGTGCCGTAACTCCTATAAGCTGAAGCATACTTTTGTTCACACAGGGTTTGGGTCAGCATAAATCTATCAAAGAAATCCCTGGGGCTAGGTAAAAGGGTTTCCTCTGGTGTAAGCGGTGTAAAACCTCCGGAATACCCTCCTATTAAGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAGTCTTTTCCGTACTCTTG