ORFeome > ccng1 ORF1 – XORFeome v1.0

ccng1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccng1
Gene ID: 6077807
Gene Page ID: 922064
ORF Xenbase ID: 17268291

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126020
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID: 900
Ensembl gene IDs: ENSG00000113328
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,133239,151623,155601,180849,211980,260500,275355,300068,308370,312300,313200,606719

Library Location

Plate ID: GDExl11083
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ837348
dbEST ID: 79655050
Trimmed Sequence: ATGATTGAAACACTTGTAACATGCAATGCTCAAGATCTTCTTTGCCAGCTGAACTCACTCTTGGAGCTGGAAGTGAAATGCCAGCCAAAAGCTTGTGGTTTACGTTTGATTGAAACTGCCCATGACAATGGCCTCCGAATGACCTCCAAGCTGCGTGACTTTGAAGTGAAAGATTTGCTTAGCTTAACTCAGTTCTTTGGTTTTAGTACTGAGACCTTCTCTTTAACTGTGAATCTTTTGGACAGGTTCTTATCCAAAATGAAGGTACAACCAAAACATTTAGGCTGTGTTGGACTTACCTGTTTCTACCTTGCTGTAAAAGCAATAGAAGAAGAAAGGAATGTTCCTCTTGCAACAGACCTACTCAGGATAAGCCAGTATAAGTTTACTGTTTTTGACATGATGCGAATGGAAAAGATTGTTCTGGAAAAGTTGGGTTGGAAAGTTAAAGCTACGACAGCCGTATACCTCTTGAAACTTTATCATTCCCTTGTGTTTGACAACCTGACAAGTGAAAGGAAAAAGCTGTTTTCTCCAGAGAGACTTGAAACTCATCTGAAAGCTTGCCACTGTAGGATTGGATTTTCCAAAGCTAAGCCCTCTGTACTGGCATTATCAATTTTGGCACTGGAGATTCAAGAACAAAAGCTGTTTGAACTAATGGATGTAATGGAGTGTCTGGCGAAACATTCCCATATTAGCCACAGAAAACTGCACTGTTTGAAAAGAACTGGGAAGGCAAAAGGCCTTTGCGAAATATGCCCTCCCGTAAATTGTTCCTTACCCAAAATTTTTTAAAAACCTCCAAATGTGAGAATTGTGGTCCG
Full Trace Sequence: TCGTGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTGAAACACTTGTAACATGCAATGCTCAAGATCTTCTTTGCCAGCTGAACTCACTCTTGGAGCTGGAAGTGAAATGCCAGCCAAAAGCTTGTGGTTTACGTTTGATTGAAACTGCCCATGACAATGGCCTCCGAATGACCTCCAAGCTGCGTGACTTTGAAGTGAAAGATTTGCTTAGCTTAACTCAGTTCTTTGGTTTTAGTACTGAGACCTTCTCTTTAACTGTGAATCTTTTGGACAGGTTCTTATCCAAAATGAAGGTACAACCAAAACATTTAGGCTGTGTTGGACTTACCTGTTTCTACCTTGCTGTAAAAGCAATAGAAGAAGAAAGGAATGTTCCTCTTGCAACAGACCTACTCAGGATAAGCCAGTATAAGTTTACTGTTTTTGACATGATGCGAATGGAAAAGATTGTTCTGGAAAAGTTGGGTTGGAAAGTTAAAGCTACGACAGCCGTATACCTCTTGAAACTTTATCATTCCCTTGTGTTTGACAACCTGACAAGTGAAAGGAAAAAGCTGTTTTCTCCAGAGAGACTTGAAACTCATCTGAAAGCTTGCCACTGTAGGATTGGATTTTCCAAAGCTAAGCCCTCTGTACTGGCATTATCAATTTTGGCACTGGAGATTCAAGAACAAAAGCTGTTTGAACTAATGGATGTAATGGAGTGTCTGGCGAAACATTCCCATATTAGCCACAGAAAACTGCACTGTTTGAAAAGAACTGGGAAGGCAAAAGGCCTTTGCGAAATATGCCCTCCCGTAAATTGTTCCTTACCCAAAATTTTTTAAAAACCTCCAAATGTGAGAATTGTGGTCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTGAAACACTTGTAACATGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837347
dbEST ID: 79655049
Trimmed Sequence: GGAGCCAGATTCTGGAATTGTTGGAAGTTGTGCTACCTTGTAGTAACTGTGCTTCAGTTGCCTTGCTGTGCGTCCTGACACAATCCACTTGAGCTTTTGAACATTTGGCTTAGAACATTTACTGGAGGCATATTCAGCAAGGCATTTGCCTACCAGTTCCTTCCAACAGTGCAGGTCTCTGCTGCTAATATTGGAATGATTCTGCAGACACTCCATTACATCCATTAGTTCAAACAGCTTCTGTTCTTGAATCTCCAGTGCCAAAATTGATAATGCCAGTACAGAGGGCTTAGCTTTGGAAAATCCAATCCTACAGTGGCAAGCTTTCAGATGAGTTTCAAGTCTCTCTGGAGAAAACAGCTTTTTCCTTTCACTTGTCAGGTTGTCAGACACAAGGGAATGATAAAGTTTCAAGAGGTATACGGCTGTCGTAGCTTTAACTTTCCAACCCAGCTTTTCCACAACAATCTTTTCCATTCGCATCATGTCTAAGGCAATAAACTTATACTGGCTTAGCCTGAGTAGGTCTGTTGGGAGAGGGAAATTCCTTTCTTCTTCTATTGCTTTGACCGGCACGTAGAGGGGGGGGGGTCGGGGCACACCCAAACGGGTTTGGTTGTAGCGTCGGTTTGGATGGGAGGGGGGTCAAAGGCATCCCAAAAAAAAAAAAAAGTCGAGAGTAGTAAGATCAAAAAAAATAAAATTAAACCAAAGTCAAATTTTTTCTCTTTCGTTTTCGCTTCGACCTTTGACAAATCCATTCCGGGAGAGCGCGATG
Full Trace Sequence: AAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGCCAGATTCTGGAATTGTTGGAAGTTGTGCTACCTTGTAGTAACTGTGCTTCAGTTGCCTTGCTGTGCGTCCTGACACAATCCACTTGAGCTTTTGAACATTTGGCTTAGAACATTTACTGGAGGCATATTCAGCAAGGCATTTGCCTACCAGTTCCTTCCAACAGTGCAGGTCTCTGCTGCTAATATTGGAATGATTCTGCAGACACTCCATTACATCCATTAGTTCAAACAGCTTCTGTTCTTGAATCTCCAGTGCCAAAATTGATAATGCCAGTACAGAGGGCTTAGCTTTGGAAAATCCAATCCTACAGTGGCAAGCTTTCAGATGAGTTTCAAGTCTCTCTGGAGAAAACAGCTTTTTCCTTTCACTTGTCAGGTTGTCAGACACAAGGGAATGATAAAGTTTCAAGAGGTATACGGCTGTCGTAGCTTTAACTTTCCAACCCAGCTTTTCCACAACAATCTTTTCCATTCGCATCATGTCTAAGGCAATAAACTTATACTGGCTTAGCCTGAGTAGGTCTGTTGGGAGAGGGAAATTCCTTTCTTCTTCTATTGCTTTGACCGGCACGTAGAGGGGGGGGGGTCGGGGCACACCCAAACGGGTTTGGTTGTAGCGTCGGTTTGGATGGGAGGGGGGTCAAAGGCATCCCAAAAAAAAAAAAAAGTCGAGAGTAGTAAGATCAAAAAAAATAAAATTAAACCAAAGTCAAATTTTTTCTCTTTCGTTTTCGCTTCGACCTTTGACAAATCCATTCCGGGAGAGCGCGATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGCCAGATTCTGGAATTGT