ORFeome > ccno ORF1 – XORFeome v1.0

ccno ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccno
Gene ID: 979551
Gene Page ID: 979544
ORF Xenbase ID: 17268339

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108598
Original XGC clone length: 1101

Human orthology & disease relationships

NCBI Entrez ID: 10309
Ensembl gene IDs: ENSG00000152669
Directly associated (OMIM) disease MIM numbers: 615872
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ837947
dbEST ID: 79655649
Trimmed Sequence: ATGGTGACCTGTAGCATGAGATGTACAGAGGAACACCTGCTGGGAGCACCGGCCGCCTTCAGCTCCGGCAAAAGGAAAAGGGACAGTGGATATTCCCCAGGGGACGCCACACCGGGGGACAGAGGAGAGGGGGGACCGGACTGGCCCAGCGCGGGGATCAAGAAGCGAGTCAAGTATTCTCGGCACAGGAAGCAGAGGCTGGAGCTGAGGAGCTGCGATTCTGGTGTGGCCGATCTCTATGAGACTCCCAGCCCGTCCCCAGTGGCGCCGACTCCGACAAATGAGCCGTACGACTCCCCCTGCACCTCCATGCCCGATAGACTCGGCCTGCAGAGCTTCAGCGACTATGGACACGACTGCTACCTGTTTAACAAGAGCCTGGAGGACAAGTTCCTTACAGTGAATTGCTTGAAAAACCAGCCCCAGATAAAGGCCGAGTCTCGCTGTAAACTTATCAGCTGGCTGATCCCTGTGCACAAACACCTTAAGCTTGGCTTTGAATCCCTTTGCCTCACAGTTAATATCTTGGACAGGTTTCTCGCCTGCACACCGGTTGCTTCCGACTGCTTCCAGCTTGTGGGCGTCACTTCTCTCCTTATTGCCTGCAAGCAGGTGGAGTCCCGGGCCTCCGCGTGTGAAGCAACCGCTGGCTCTGTGCTGTGATGCCTTTTCCAGGGGACAGTTGGTGCAATTTGGAATGTATTATCCTTCCTCAACCTTTGCTTCCCCCATCGGAACCCCCAACCATAAAACTTTTTTTCCTGCAACCCTTCTCTCCCTTTCCAAAAATTAACCCAGCCGTTGGAAATCCCCCCTGTGAACCTGG
Full Trace Sequence: CGAGGGCCCAAATAAGTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGACCTGTAGCATGAGATGTACAGAGGAACACCTGCTGGGAGCACCGGCCGCCTTCAGCTCCGGCAAAAGGAAAAGGGACAGTGGATATTCCCCAGGGGACGCCACACCGGGGGACAGAGGAGAGGGGGGACCGGACTGGCCCAGCGCGGGGATCAAGAAGCGAGTCAAGTATTCTCGGCACAGGAAGCAGAGGCTGGAGCTGAGGAGCTGCGATTCTGGTGTGGCCGATCTCTATGAGACTCCCAGCCCGTCCCCAGTGGCGCCGACTCCGACAAATGAGCCGTACGACTCCCCCTGCACCTCCATGCCCGATAGACTCGGCCTGCAGAGCTTCAGCGACTATGGACACGACTGCTACCTGTTTAACAAGAGCCTGGAGGACAAGTTCCTTACAGTGAATTGCTTGAAAAACCAGCCCCAGATAAAGGCCGAGTCTCGCTGTAAACTTATCAGCTGGCTGATCCCTGTGCACAAACACCTTAAGCTTGGCTTTGAATCCCTTTGCCTCACAGTTAATATCTTGGACAGGTTTCTCGCCTGCACACCGGTTGCTTCCGACTGCTTCCAGCTTGTGGGCGTCACTTCTCTCCTTATTGCCTGCAAGCAGGTGGAGTCCCGGGCCTCCGCGTGTGAAGCAACCGCTGGCTCTGTGCTGTGATGCCTTTTCCAGGGGACAGTTGGTGCAATTTGGAATGTATTATCCTTCCTCAACCTTTGCTTCCCCCATCGGAACCCCCAACCATAAAACTTTTTTTCCTGCAACCCTTCTCTCCCTTTCCAAAAATTAACCCAGCCGTTGGAAATCCCCCCTGTGAACCTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGACCTGTAGCATGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837946
dbEST ID: 79655648
Trimmed Sequence: GTTATCCGCTTTGATGCTCTTGACAGAAAACTGACTTGGTAGGAGGCGGTGCAAGGAGTCTTGGTTTAAGGAGACAAGTAAGTCGATCTTGCCCACACACTCCTTTATTAAGCTCTGGTGATAGCCACTGACCCGCACACCGATTGGGTTCCTAAGGCACAACATGCGATCGGCAAGTTCCAGGCAGCACGCGGCCACGAGGGATGGAGAATAGGCGTTGAAGGCATAATCTGCCAGGCTCAGTTCTGCAATGCCTCTGGCGACGGTCATGGACTTGGTGGCTTCGATGAGCTCAGTGTCAGGGGATTCCACGCTGGTTACTCTCAGAAGGGAGAAGTGTTGCAGGAAGAAGTTTATAGTAGGGGCTCCGATGCGGAAGCACAGCTTGAGGAGGATAATACACTCCAAATTGCACAACTGTTCCCTGGAAAAGGCATCACAGCACAGAGCCAGCAGCTGCTTCACACGCGGAGGCCGGGACTCCACCTGCTTGCAGGCAATAAGGAGAGAAGTGACGCCCACAAGCTGGAAGCAGTCGGAAGCAACCGGTGTGCAGGCGAGAAACCTGTCCAAGATATTAACTGGGAGGCCAGAGGGAGTCCAACCCCACTTTTAGGTGGTTGGTGCAACGGGGATCAGCCCGCTTAATAGTTTTACAACGAAAACTCGGCCCTTTATCTGGGGGGCTTGGTGTTTTCAGGCGGATTCAATGGTAAGGAAACTTTGCTCCTCCCAGCGCCTTTTGTTTAACCCAGGGGTGAACCAAGTCCTGTGTTC
Full Trace Sequence: AAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTATCCGCTTTGATGCTCTTGACAGAAAACTGACTTGGTAGGAGGCGGTGCAAGGAGTCTTGGTTTAAGGAGACAAGTAAGTCGATCTTGCCCACACACTCCTTTATTAAGCTCTGGTGATAGCCACTGACCCGCACACCGATTGGGTTCCTAAGGCACAACATGCGATCGGCAAGTTCCAGGCAGCACGCGGCCACGAGGGATGGAGAATAGGCGTTGAAGGCATAATCTGCCAGGCTCAGTTCTGCAATGCCTCTGGCGACGGTCATGGACTTGGTGGCTTCGATGAGCTCAGTGTCAGGGGATTCCACGCTGGTTACTCTCAGAAGGGAGAAGTGTTGCAGGAAGAAGTTTATAGTAGGGGCTCCGATGCGGAAGCACAGCTTGAGGAGGATAATACACTCCAAATTGCACAACTGTTCCCTGGAAAAGGCATCACAGCACAGAGCCAGCAGCTGCTTCACACGCGGAGGCCGGGACTCCACCTGCTTGCAGGCAATAAGGAGAGAAGTGACGCCCACAAGCTGGAAGCAGTCGGAAGCAACCGGTGTGCAGGCGAGAAACCTGTCCAAGATATTAACTGGGAGGCCAGAGGGAGTCCAACCCCACTTTTAGGTGGTTGGTGCAACGGGGATCAGCCCGCTTAATAGTTTTACAACGAAAACTCGGCCCTTTATCTGGGGGGCTTGGTGTTTTCAGGCGGATTCAATGGTAAGGAAACTTTGCTCCTCCCAGCGCCTTTTGTTTAACCCAGGGGTGAACCAAGTCCTGTGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATCCGCTTTGATGCTCT