ORFeome > cct3 ORF1 – XORFeome v1.0

cct3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cct3
Gene ID: 6250719
Gene Page ID: 6250477
ORF Xenbase ID: 17268393

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC048365
Original XGC clone length: 1644

Human orthology & disease relationships

NCBI Entrez ID: 7203
Ensembl gene IDs: ENSG00000163468
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11008
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ823602
dbEST ID: 79641304
Trimmed Sequence: ATGATGGGCCGCCCGGTGCTCGTGCTGAGCCAGAACATGAAACGGGAGTCTGGGAGGAAAGTCCAGAGCGGGAATATCAACGCTGCAAAGACCATCGCAGACATCATTCGAACATGCCTTGGGCCAAGGGCAATGATGAAGATGCTGCTGGATCCCATGGGTGGCATTGTAATGACCAACGATGGCAATGCAATTCTTAGAGAGATCCAGGTGCAGCACCCGGCTGCCAAGTCCATGATAGAAATCAGTCGTACCCAGGACGAGGAGGTCGGTGATGGAACCACTTCTGTTATCATTCTGGCCGGAGAGATGTTGTCTGTCGCTGAACAGTTTCTGGAGCAACAAATGCACCCGACTGTGATTATCAGCGCCTATAGGAAAGCCCTGGATGATATGGTCAATACTCTGAAGGAGATCAGCACCCCAGTCGATACAAACGACCGTGAGCTGATGTTAAAGATCATTAACAGCGCCATCAATACCAAAGCGATCAAGCTCTGGGCAGATATGGCCTGTGGCATCGCCCTGGATGCTGTGAAAACCGTCGAATTGGAGGAGAACGGCCGAAAGGAGATTGACATCAAGAAATACGCCAAAGTGGAGAAGATTCCTGGAGGGATCATTGAAGACTCCTGTGTGCTACGAGGCGTCATGGTCAACAAAGACGTCACTCACCCCAAAATGCGGCGGTTGATCAAGAAC
Full Trace Sequence: CCATTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGGCCGCCCGGTGCTCGTGCTGAGCCAGAACATGAAACGGGAGTCTGGGAGGAAAGTCCAGAGCGGGAATATCAACGCTGCAAAGACCATCGCAGACATCATTCGAACATGCCTTGGGCCAAGGGCAATGATGAAGATGCTGCTGGATCCCATGGGTGGCATTGTAATGACCAACGATGGCAATGCAATTCTTAGAGAGATCCAGGTGCAGCACCCGGCTGCCAAGTCCATGATAGAAATCAGTCGTACCCAGGACGAGGAGGTCGGTGATGGAACCACTTCTGTTATCATTCTGGCCGGAGAGATGTTGTCTGTCGCTGAACAGTTTCTGGAGCAACAAATGCACCCGACTGTGATTATCAGCGCCTATAGGAAAGCCCTGGATGATATGGTCAATACTCTGAAGGAGATCAGCACCCCAGTCGATACAAACGACCGTGAGCTGATGTTAAAGATCATTAACAGCGCCATCAATACCAAAGCGATCAAGCTCTGGGCAGATATGGCCTGTGGCATCGCCCTGGATGCTGTGAAAACCGTCGAATTGGAGGAGAACGGCCGAAAGGAGATTGACATCAAGAAATACGCCAAAGTGGAGAAGATTCCTGGAGGGATCATTGAAGACTCCTGTGTGCTACGAGGCGTCATGGTCAACAAAGACGTCACTCACCCCAAAATGCGGCGGTTGATCAAGAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGGCCGCCCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828901
dbEST ID: 79646603
Trimmed Sequence: TTCTGCTTGTTGGGGTGCCTCTGGGGCTGCTGCTGGCTGTCTGCCATGGTCTTCTCCCTTTTTCTTGTGGCCGGATACAATGTCATCAATGCGGAGCAGCAGAATGGCCGTCTCCACTGCAGTTTTGTAGGTTTGCAGTTTGACAGCCAGTGGCTCCCAGATGCCCAGCTCCTTCATGTCGGCCAGTACTCCAGCCTCCCCATCCACTCCCCAGGTCTGGCAACCTTCCTGAGTGTGTTTGGCCCTCAGAGAAGTGAGTATACGGATGGTGCTGGCACCACAATTCTGGATGAGAGTCCTGGGAATGACCTCGAGGGCCTGCGCCACTGCACGGTACGGCCACTGCTCCACCCCAGTCATAGTCTTGGATTTCTCAGTGAGTATATGAGCCACGCTCATCTCAGAGGCTCCGCCCCCTGGCACCAGGTAAGGGTCGATCACCACATTACGACAGACTTGCATGGCGTCCTGCAGGTTACGCTCCACCTCTGCCAGAATCTCTTTGCTGGCTCCACGCAAGACAATGGTGCAGGCTTTGGGATCCTTGCAGTCAGTGATGAAGGTGAAATACTCATCTCCCATCTTCTTAATTTCAAAAAGACCAGCGCCAGTGCCAACGTCTTCTTCACGCAGTTCATCTGTGCGGCTGGCTATGC
Full Trace Sequence: AGCTGACAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTGCTTGTTGGGGTGCCTCTGGGGCTGCTGCTGGCTGTCTGCCATGGTCTTCTCCCTTTTTCTTGTGGCCGGATACAATGTCATCAATGCGGAGCAGCAGAATGGCCGTCTCCACTGCAGTTTTGTAGGTTTGCAGTTTGACAGCCAGTGGCTCCCAGATGCCCAGCTCCTTCATGTCGGCCAGTACTCCAGCCTCCCCATCCACTCCCCAGGTCTGGCAACCTTCCTGAGTGTGTTTGGCCCTCAGAGAAGTGAGTATACGGATGGTGCTGGCACCACAATTCTGGATGAGAGTCCTGGGAATGACCTCGAGGGCCTGCGCCACTGCACGGTACGGCCACTGCTCCACCCCAGTCATAGTCTTGGATTTCTCAGTGAGTATATGAGCCACGCTCATCTCAGAGGCTCCGCCCCCTGGCACCAGGTAAGGGTCGATCACCACATTACGACAGACTTGCATGGCGTCCTGCAGGTTACGCTCCACCTCTGCCAGAATCTCTTTGCTGGCTCCACGCAAGACAATGGTGCAGGCTTTGGGATCCTTGCAGTCAGTGATGAAGGTGAAATACTCATCTCCCATCTTCTTAATTTCAAAAAGACCAGCGCCAGTGCCAACGTCTTCTTCACGCAGTTCATCTGTGCGGCTGGCTATGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGCTTGTTGGGGTGCCT