ORFeome > cct5 ORF1 – XORFeome v1.0

cct5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cct5
Gene ID: 980281
Gene Page ID: 980274
ORF Xenbase ID: 17268405

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044997
Original XGC clone length: 1626

Human orthology & disease relationships

NCBI Entrez ID: 22948
Ensembl gene IDs: ENSG00000150753,LRG_361
Directly associated (OMIM) disease MIM numbers: 256840
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ823954
dbEST ID: 79641656
Trimmed Sequence: ATGTCAGCGCTTGGAACTCTCGCCTTCGACGATTATGGGCGACCTTTTATTATCATCAAAGACCAGGATCGCAAGTCTCGGCTCTGTGGGCTAGATGCGCTCAAGTCTCATATTATGGCAGCCAAAGCAGTTGCAAACACACTAAGAACATCACTTGGACCTAATGGACTTGATAAGATGATGGTGGATAAGGATGGGCAAGTTACAGTCACCAACGATGGTGCAACCATTCTTGGCATGATGGATGTGGATCACCAAATTGCCAAACTGATGGTTGAATTGTCTAAGTCTCAAGATGATGAAATTGGCGATGGCACTACAGGTGTTGTAGTTCTTGCTGGTGCATTGCTGGAACAAGCTGAACAGTTGTTAGATCGTGGTATCCACCCTATCAGGATTGCTGATGGGTATGAACAAGCTGCACGTATCGCTGTTGAACATCTTGACAAGATCAGTGACAGTTTTCCAGTTGATCTTGAGAACTTGGAGCCACTTATTCAAACGGCAATGACAACGCTGGGTTCAAAAGTGATTAACCGCTGCCACCGACAGATGGCTGAAATTGCAGTGAATAGCATTTTGACTGTTGCGGATATGGATCGTAAAGATGTTGACTTTGAGTTGATAAAGGTTGAAGGTAAAGTTGGAGGTAAACTAGAAGATACAAAACTGATCAAAGGTGTTATAGTGGACAAGGACTTCAGCCACCCTCAGATGCAAAAAGTAGTGAAAGATGCTAAAATCGCCAATTCTCACTTTGTCCGTTTGAACCAACAAAGCCCCAAGAC
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGCGCTTGGAACTCTCGCCTTCGACGATTATGGGCGACCTTTTATTATCATCAAAGACCAGGATCGCAAGTCTCGGCTCTGTGGGCTAGATGCGCTCAAGTCTCATATTATGGCAGCCAAAGCAGTTGCAAACACACTAAGAACATCACTTGGACCTAATGGACTTGATAAGATGATGGTGGATAAGGATGGGCAAGTTACAGTCACCAACGATGGTGCAACCATTCTTGGCATGATGGATGTGGATCACCAAATTGCCAAACTGATGGTTGAATTGTCTAAGTCTCAAGATGATGAAATTGGCGATGGCACTACAGGTGTTGTAGTTCTTGCTGGTGCATTGCTGGAACAAGCTGAACAGTTGTTAGATCGTGGTATCCACCCTATCAGGATTGCTGATGGGTATGAACAAGCTGCACGTATCGCTGTTGAACATCTTGACAAGATCAGTGACAGTTTTCCAGTTGATCTTGAGAACTTGGAGCCACTTATTCAAACGGCAATGACAACGCTGGGTTCAAAAGTGATTAACCGCTGCCACCGACAGATGGCTGAAATTGCAGTGAATAGCATTTTGACTGTTGCGGATATGGATCGTAAAGATGTTGACTTTGAGTTGATAAAGGTTGAAGGTAAAGTTGGAGGTAAACTAGAAGATACAAAACTGATCAAAGGTGTTATAGTGGACAAGGACTTCAGCCACCCTCAGATGCAAAAAGTAGTGAAAGATGCTAAAATCGCCAATTCTCACTTTGTCCGTTTGAACCAACAAAGCCCCAAGAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCGCTTGGAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ829263
dbEST ID: 79646965
Trimmed Sequence: CTCTTCCGTTTCGCCAGGCCGACGGATGTCATCTATTTTCAAGATCATTTTAACAACTTGTGTAGCCAACGAAATCTGCTGTTTCTTGCCAATTAATGTTTCTATGACATGCTGTTGCTTCATATCATTTGTGCCCTTATGCAGGCAATCAATGCCAAGTGCTGGGTTGCTTTCCTTCACCTGTCTAGAGCGTACTTCAGTCATTGTCTGAATAGGATTCATACCACTGTTTTCAGCAAGCGACATAGGAATAACTTCCAGTGCATCAGCAAAGGCTCTCATGGCATATTGTTCCAGAGATGGACACTTATCTGCAGCCTGGCTAACTGCTAAAGCACAGGAGATCTCTGCAGCCCCTCCTCCATATACAATGCGATTGTCCCTTACTAGGTTACGAATGACACACAAAGCATCATGGAGTGAACGCTTTGCTTCTTCAATTATCATCTTATTTCCTCCTCTGATGAAAATAGTTACAGCTCTGGAGTTCTTACATTGCTCAATAACAAGCATTCGATCCTTAGTTGTGCCAAAAGAATTTCTTTTTACATGCCAGCATAGCCAAGTTTCTCTGGAGTTACTCACAAAATCGTGGGACCATACGGCCTCCCGTTGCAATAGCATTTAACTCTATTTCTGGTCCACCCACCCAACGAACAGCAGGAAGTTTCTTTTTGTAATAATAAGGGATTTGCTTCATCATCAAAACCCCCCTGGGCTTATGGGCAAGAAATTTTACCCCCGGTTT
Full Trace Sequence: CTGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTCCGTTTCGCCAGGCCGACGGATGTCATCTATTTTCAAGATCATTTTAACAACTTGTGTAGCCAACGAAATCTGCTGTTTCTTGCCAATTAATGTTTCTATGACATGCTGTTGCTTCATATCATTTGTGCCCTTATGCAGGCAATCAATGCCAAGTGCTGGGTTGCTTTCCTTCACCTGTCTAGAGCGTACTTCAGTCATTGTCTGAATAGGATTCATACCACTGTTTTCAGCAAGCGACATAGGAATAACTTCCAGTGCATCAGCAAAGGCTCTCATGGCATATTGTTCCAGAGATGGACACTTATCTGCAGCCTGGCTAACTGCTAAAGCACAGGAGATCTCTGCAGCCCCTCCTCCATATACAATGCGATTGTCCCTTACTAGGTTACGAATGACACACAAAGCATCATGGAGTGAACGCTTTGCTTCTTCAATTATCATCTTATTTCCTCCTCTGATGAAAATAGTTACAGCTCTGGAGTTCTTACATTGCTCAATAACAAGCATTCGATCCTTAGTTGTGCCAAAAGAATTTCTTTTTACATGCCAGCATAGCCAAGTTTCTCTGGAGTTACTCACAAAATCGTGGGACCATACGGCCTCCCGTTGCAATAGCATTTAACTCTATTTCTGGTCCACCCACCCAACGAACAGCAGGAAGTTTCTTTTTGTAATAATAAGGGATTTGCTTCATCATCAAAACCCCCCTGGGCTTATGGGCAAGAAATTTTACCCCCGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTCCGTTTCGCCAG