ORFeome > cct8 ORF1 – XORFeome v1.0

cct8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cct8
Gene ID: 974323
Gene Page ID: 974315
ORF Xenbase ID: 17268429

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045040
Original XGC clone length: 1641

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ824168
dbEST ID: 79641870
Trimmed Sequence: ATGGCGCTGCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTGAAGGAAGGAGCCAAGCACTACTCTGGCTTGGAAGAAGCAGTGTTCCGTAATATCCAGGCCTGTAAAGAACTCCCCCCAGACTACACGCACTGCCTATGGACCAAATGGAATGAACAAGATGGTTATCAATCATTTGGAGAAGCTTTTCGTTACAAACGATGCCGCCACCATTATAAGGGAACTAGAGGTTCAACATCCAGCTGCCAAAATGATTGTGATGGCTTCCCACATGCAAGAGCAGGAGGTCGGAGACGGGACTAACTTTGTCCTGGTCTTTGCTGGAGCTTTACTTGAGCTGGCAGAAGAGCTTCTAAGAATGGGACTGTCTGTATCCGAGGTGATTGAAGGCTATGAAAAGGCCTGTAAGAAAGCCTTAGAAATACTCCCCGACCTGGTCTGCAGTTCTGCAAAGAATTTACGTGATGTTGATGAAGTGGCCTCCCTTCTTCAGACGGCCATCATGAGCAAACAGTATGGCAACGAGCTCTTTCTTTCCAAGCTCATCGCCTAGGCGTGTGTGTCTATCCTTCCCGACTCTGGCAATTTCAATGTTGACAACATCAGAGTGTGCAAGAATTTGGGATCGGGTATCTGCTCCCTCTTCTGTCTGCACGGCATGGTTTTCAAAAAGGAAGTAGAGGGAGATATACTCCTGTTGAAAAGCCCAAATCCCATTAATTTCCCGTCCCGTTTGATGGCCCAATCACGGAACCAAGGGGACCTTGCCTTATACCACCGCCGGGACCGGGGGATTTTCCCAACGAAAAAGAAACAAAGGAGGGGAGAGAGAAGGGGAGGAAAAG
Full Trace Sequence: AATTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTGAAGGAAGGAGCCAAGCACTACTCTGGCTTGGAAGAAGCAGTGTTCCGTAATATCCAGGCCTGTAAAGAACTCCCCCCAGACTACACGCACTGCCTATGGACCAAATGGAATGAACAAGATGGTTATCAATCATTTGGAGAAGCTTTTCGTTACAAACGATGCCGCCACCATTATAAGGGAACTAGAGGTTCAACATCCAGCTGCCAAAATGATTGTGATGGCTTCCCACATGCAAGAGCAGGAGGTCGGAGACGGGACTAACTTTGTCCTGGTCTTTGCTGGAGCTTTACTTGAGCTGGCAGAAGAGCTTCTAAGAATGGGACTGTCTGTATCCGAGGTGATTGAAGGCTATGAAAAGGCCTGTAAGAAAGCCTTAGAAATACTCCCCGACCTGGTCTGCAGTTCTGCAAAGAATTTACGTGATGTTGATGAAGTGGCCTCCCTTCTTCAGACGGCCATCATGAGCAAACAGTATGGCAACGAGCTCTTTCTTTCCAAGCTCATCGCCTAGGCGTGTGTGTCTATCCTTCCCGACTCTGGCAATTTCAATGTTGACAACATCAGAGTGTGCAAGAATTTGGGATCGGGTATCTGCTCCCTCTTCTGTCTGCACGGCATGGTTTTCAAAAAGGAAGTAGAGGGAGATATACTCCTGTTGAAAAGCCCAAATCCCATTAATTTCCCGTCCCGTTTGATGGCCCAATCACGGAACCAAGGGGACCTTGCCTTATACCACCGCCGGGACCGGGGGATTTTCCCAACGAAAAAGAAACAAAGGAGGGGAGAGAGAAGGGGAGGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCACGTCCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829473
dbEST ID: 79647175
Trimmed Sequence: CTCGTCATCATCCCAGTCCTTCTTTCCCGTCGGTGCTTTTGGGCCGCCCGCTGGTTTTGCCATGATGATCTGGTCAACCCGAAGTACAGTAATCGCTGCGTTTGTGGCCAACTTTATCCCCCAGTATTTCACTAGATACGTGTCCAATATCTTGCTCTCCATCATGTCTTTCACTGCCGCAGTCTCCGCCTCGATGTCGAATCCCACGTTCTTGTTGCCTTCCTGGTGCATGGCGTAGAGTTTGGAGAGGACTTCATTGGCCTTGACACCAGAGTTTCCAGCCAATGCCCTTGGAATGGACTCAAAGGCTTCAGCAAACTTTTTAATGGCGTATTGATCCAGCCCAGGGCAGGTCTCTCCATAAGATGTTATGTGTTTCGCCAACTCGATTTCCACTGCTCCTCCTCCGGGTACAAGGCGCTTGTCCCGTGTGAGGACTTTGAAAGTGTTCACGGCGTCATCTACGGCTCTTTCCACGTCGTCCATGAGGTTGTCTGTGGAGCCGCGGATCACAATTGTAGCAATGGCCCCGTCTTCTTTTTCATGTTTGAACACAACAACTTGTGTATCCCCAACTTCTGACAAGTAAACACTGTCACAGTGTCCAATCTCCTCTGCTGTAGGAGGGGTCATCCTGGGAGAGGCAGTTGCACATACCGTTTTTGCACAGTCCTCAAAGATCCCCTTTGGAATTTTAACCTTTACAACCATGAAGGTTTGTTTTTTGTTTTGCGTAAAGGGAAAAAACCCAGGTTTCGGCCAACT
Full Trace Sequence: CGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGTCATCATCCCAGTCCTTCTTTCCCGTCGGTGCTTTTGGGCCGCCCGCTGGTTTTGCCATGATGATCTGGTCAACCCGAAGTACAGTAATCGCTGCGTTTGTGGCCAACTTTATCCCCCAGTATTTCACTAGATACGTGTCCAATATCTTGCTCTCCATCATGTCTTTCACTGCCGCAGTCTCCGCCTCGATGTCGAATCCCACGTTCTTGTTGCCTTCCTGGTGCATGGCGTAGAGTTTGGAGAGGACTTCATTGGCCTTGACACCAGAGTTTCCAGCCAATGCCCTTGGAATGGACTCAAAGGCTTCAGCAAACTTTTTAATGGCGTATTGATCCAGCCCAGGGCAGGTCTCTCCATAAGATGTTATGTGTTTCGCCAACTCGATTTCCACTGCTCCTCCTCCGGGTACAAGGCGCTTGTCCCGTGTGAGGACTTTGAAAGTGTTCACGGCGTCATCTACGGCTCTTTCCACGTCGTCCATGAGGTTGTCTGTGGAGCCGCGGATCACAATTGTAGCAATGGCCCCGTCTTCTTTTTCATGTTTGAACACAACAACTTGTGTATCCCCAACTTCTGACAAGTAAACACTGTCACAGTGTCCAATCTCCTCTGCTGTAGGAGGGGTCATCCTGGGAGAGGCAGTTGCACATACCGTTTTTGCACAGTCCTCAAAGATCCCCTTTGGAATTTTAACCTTTACAACCATGAAGGTTTGTTTTTTGTTTTGCGTAAAGGGAAAAAACCCAGGTTTCGGCCAACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGTCATCATCCCAGTCCTT