ORFeome > cd28 ORF1 – XORFeome v1.0

cd28 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd28
Gene ID: 6487529
Gene Page ID: 489231
ORF Xenbase ID: 17268453

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129734
Original XGC clone length: 618

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838944
dbEST ID: 79656646
Trimmed Sequence: ATGGCCTTCATTCTAATTTGCATTACTCAATGCACAGGTATTTCATCAGAAACACAACAGCAAACTGTTCTTATTGCAATAGAACAAATTGACATAACGTTTACCAGCAACTTTAAAGATAACAAAGAATTCCGGGTGTCATTGTTCAAAGGGGTAAAAAAGTCCATCACTGTCTGCAGTGGATCCTTCAACTCCTCCTATCAGTCATTTGAGTCCAACTCAAACCAGTCCATAAAGGGCCTTGGCATTCCTACTGAAAGCAAAATCACCCTTTATCTGTCGGGCCTGACTGAGAATGACACAGACATTTATTATTTCCACAAAGAGAATATGTATCCACCTCCTTATACTTGTTATCAAGACAATGGCACTGTCATTCATGTAAAAGAGTTAGTCCCTACAGGAAAGCCAACTTTACCACAGCCTATTTTGCCATTGCTGGTTGGCATTGGAGTTACAGTAGCATACAGCGTTGCAATTACGGCAGCATTTTGTTACGTTTTGAAAAAAGGAAGGAGAACGAGGGTGCTACAGAGTGAATACATCAATGTGGTTCCACGCAGGCCAAAGTGTCATCAGCCGTATGCTCCCACTCCTGCCCACTGTCGCCCTCGCTT
Full Trace Sequence: GGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTTCATTCTAATTTGCATTACTCAATGCACAGGTATTTCATCAGAAACACAACAGCAAACTGTTCTTATTGCAATAGAACAAATTGACATAACGTTTACCAGCAACTTTAAAGATAACAAAGAATTCCGGGTGTCATTGTTCAAAGGGGTAAAAAAGTCCATCACTGTCTGCAGTGGATCCTTCAACTCCTCCTATCAGTCATTTGAGTCCAACTCAAACCAGTCCATAAAGGGCCTTGGCATTCCTACTGAAAGCAAAATCACCCTTTATCTGTCGGGCCTGACTGAGAATGACACAGACATTTATTATTTCCACAAAGAGAATATGTATCCACCTCCTTATACTTGTTATCAAGACAATGGCACTGTCATTCATGTAAAAGAGTTAGTCCCTACAGGAAAGCCAACTTTACCACAGCCTATTTTGCCATTGCTGGTTGGCATTGGAGTTACAGTAGCATACAGCGTTGCAATTACGGCAGCATTTTGTTACGTTTTGAAAAAAGGAAGGAGAACGAGGGTGCTACAGAGTGAATACATCAATGTGGTTCCACGCAGGCCAAAGTGTCATCAGCCGTATGCTCCCACTCCTGCCCACTGTCGCCCTCGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGGCAACGAAAGGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATTCCAGCTGAAATCCCCCATTATGAATCCAATTAAATGGTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTTCATTCTAATTTGCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ838943
dbEST ID: 79656645
Trimmed Sequence: GCGAGGGCGACAGTGGGCAGGAGTGGGAGCATACGGCTGATGACACTTTGGCCTGCGTGGAACCACATTGATGTATTCACTCTGTAGCACCCTCGTTCTCCTTCCTTTTTTCAAAACGTAACAAAATGCTGCCGTAATTGCAACGCTGTATGCTACTGTAACTCCAATGCCAACCAGCAATGGCAAAATAGGCTGTGGTAAAGTTGGCTTTCCTGTAGGGACTAACTCTTTTACATGAATGACAGTGCCATTGTCTTGATAACAAGTATAAGGAGGTGGATACATATTCTCTTTGTGGAAATAATAAATGTCTGTGTCATTCTCAGTCAGGCCCGACAGATAAAGGGTGATTTTGCTTTCAGTAGGAATGCCAAGGCCCTTTATGGACTGGTTTGAGTTGGACTCAAATGACTGATAGGAGGAGTTGAAGGATCCACTGCAGACAGTGATGGACTTTTTTACCCCTTTGAACAATGACACCCGGAATTCTTTGTTATCTTTAAAGTTGCTGGTAAACGTTATGTCAATTTGTTCTATTGCCATAAGAACAGTTTGCTGTTGTGGTTCTGATGAAATACCTGTGCATTGAAGTAATGCAATTAGAATGAAGGCCCATGG
Full Trace Sequence: GGGTAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGAGGGCGACAGTGGGCAGGAGTGGGAGCATACGGCTGATGACACTTTGGCCTGCGTGGAACCACATTGATGTATTCACTCTGTAGCACCCTCGTTCTCCTTCCTTTTTTCAAAACGTAACAAAATGCTGCCGTAATTGCAACGCTGTATGCTACTGTAACTCCAATGCCAACCAGCAATGGCAAAATAGGCTGTGGTAAAGTTGGCTTTCCTGTAGGGACTAACTCTTTTACATGAATGACAGTGCCATTGTCTTGATAACAAGTATAAGGAGGTGGATACATATTCTCTTTGTGGAAATAATAAATGTCTGTGTCATTCTCAGTCAGGCCCGACAGATAAAGGGTGATTTTGCTTTCAGTAGGAATGCCAAGGCCCTTTATGGACTGGTTTGAGTTGGACTCAAATGACTGATAGGAGGAGTTGAAGGATCCACTGCAGACAGTGATGGACTTTTTTACCCCTTTGAACAATGACACCCGGAATTCTTTGTTATCTTTAAAGTTGCTGGTAAACGTTATGTCAATTTGTTCTATTGCCATAAGAACAGTTTGCTGTTGTGGTTCTGATGAAATACCTGTGCATTGAAGTAATGCAATTAGAATGAAGGCCCATGGTGCCAACTTTTTTGGAACAAATTTGCATTAAAAAAAAAAAATTGCTCATCAATTTTTTGCAACCAACAGGTTCCTATCCATTCAAAATAAAAACAATAAATAAAAAAAAAAAAAATAAAAAAAAGAAAGAAAAAAAAAAAAAAAAAAAAACAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGAGGGCGACAGTGGG