ORFeome > cd2bp2 ORF2 – XORFeome v1.0

cd2bp2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd2bp2
Gene ID: 1016918
Gene Page ID: 1016909
ORF Xenbase ID: 17268471

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108870
Original XGC clone length: 1212

Human orthology & disease relationships

NCBI Entrez ID: 10421
Ensembl gene IDs: ENSG00000169217
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,600059,600995,604416,607832,609065,609227

Library Location

Plate ID: GDExl11083
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ837233
dbEST ID: 79654935
Trimmed Sequence: ATGTCTAAGAGGAAGGTCACTTTTGTGGATGGAGTTGAAGAGGGTGATGATGAGCAGAAAAAAAGAAGGCTCCCGGATGTAGCGGCAGGCCCGGGAAGTCGATTTAAAGGGAAACATTCTCTGGACAGCGATGAGGAAGATGATGACGATGAAACCAGTGATGGACGTTCTGCAAAGTATGACATATTGGCACCAGAGGATGTTGAAGGACAAGAGAACGCTACTCTGGACTCGGAGGGTGGCGTACCAATTACTCCTTTTAACCTGAAGGAAGAAATGGAGGAGGGGCACTTTGATTCAGAGGGCAACTATTTTTTGCGTAAGGAGGACCAGATTCGGGACCACTGGCTTGATAATATTGACTGGGTCCGTATTAAGGAGCCCACTGCACCCGCAGTTTCCACAGATGATTACTCTGATTCCGAGGAGGGAAGGGCACCACTGAGTAAGAAGGTGCTACTAGAGGGAATCTTGCAGTTGCTCCAGCCTGGGGAGACTGTGGCTAAAGGAATCCAACGTCTTGGAGGGACACGAGGCAAAAAGACTACTGGGGGGCAGAGAGCAAGACAGAGGCAGAACCCAGCAGTCAGAATAAAAAATAGAGGGACTAAGTTATAATAAGACAAAAAGCACCAATATAATGCAGATTCGAAAATGGACAAAGGAAGAGCGGATTCAAGGCAGGAGGCGGAGCAGAAACAAAATAAAGAGAACTGAAACCCGGGTTGGAAGGTGGAAGGGGGGGAGGAAGTCCCCTGAGGGAAAAACCCCAAAAAAAATGGGGAAAACCCGGAAGCCCGGCCAAAAACCAGGGGAA
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGAGGAAGGTCACTTTTGTGGATGGAGTTGAAGAGGGTGATGATGAGCAGAAAAAAAGAAGGCTCCCGGATGTAGCGGCAGGCCCGGGAAGTCGATTTAAAGGGAAACATTCTCTGGACAGCGATGAGGAAGATGATGACGATGAAACCAGTGATGGACGTTCTGCAAAGTATGACATATTGGCACCAGAGGATGTTGAAGGACAAGAGAACGCTACTCTGGACTCGGAGGGTGGCGTACCAATTACTCCTTTTAACCTGAAGGAAGAAATGGAGGAGGGGCACTTTGATTCAGAGGGCAACTATTTTTTGCGTAAGGAGGACCAGATTCGGGACCACTGGCTTGATAATATTGACTGGGTCCGTATTAAGGAGCCCACTGCACCCGCAGTTTCCACAGATGATTACTCTGATTCCGAGGAGGGAAGGGCACCACTGAGTAAGAAGGTGCTACTAGAGGGAATCTTGCAGTTGCTCCAGCCTGGGGAGACTGTGGCTAAAGGAATCCAACGTCTTGGAGGGACACGAGGCAAAAAGACTACTGGGGGGCAGAGAGCAAGACAGAGGCAGAACCCAGCAGTCAGAATAAAAAATAGAGGGACTAAGTTATAATAAGACAAAAAGCACCAATATAATGCAGATTCGAAAATGGACAAAGGAAGAGCGGATTCAAGGCAGGAGGCGGAGCAGAAACAAAATAAAGAGAACTGAAACCCGGGTTGGAAGGTGGAAGGGGGGGAGGAAGTCCCCTGAGGGAAAAACCCCAAAAAAAATGGGGAAAACCCGGAAGCCCGGCCAAAAACCAGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAAGAGGAAGGTCACTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837232
dbEST ID: 79654934
Trimmed Sequence: CACGTACAGCTCAAAGTCTATCCTCTGCGAGTTGTAGAACTGACCCTCGGAGCCGCTCACTCGCCGGCAATAAACTCCCCCGGCAAAATAGCCCTGATCCACCCATTCCTGCATCTGTGTGCTGGAGAAGGGCCCGTACAGTTCCACTCCGTCTTTGTTCTCCCATTTGTACTCCCACATAACTTCATCCGATAACTGTGAATCTGCTGCCTTCTCCAGGGTTTGCTCTTCCACCTCATCAGCAAACATGTCCAGCTCAGCAGGTGGAGCCATGGTCTTGAGTCTGTATGCCAACTTCTCGTACGTGTCCTGATAGATCTCATACACTCCAAGGGCCACCATCTGATCTGCTAGAGATATGAGCAGCTCCAGGGGCTCTGGCCTATCTTCTGACTTGTTTGTTCCCTCCCTACTCTGTGCAGTTTCTGGTTTCCCATTATCTTGTGCTCTCTCCTTTAGGGACTCCTGACCCTGTTCACTTCCAACCCGGCTTTCCAGTTCCTTATTTTGTTCATCGTTGCTCTCTTGCCTTGAATCCGTTTCTCCCTCGTCCATTTTCGAATCTGCATTATATTCGTGCTCTCTGTCCTCCTTCTACCTAATCCCTCTATTCTTTCTTCTGAACGCTGGGTTCTGGCCGTCGTCCTGCTCTCTGCCCCCCAGTTAGTCCTTTTTGCCTCTTGCCCTCCCAAAAGGTTGGAATTCCTTTTGGCCAAA
Full Trace Sequence: AAAACGGCTAATGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGTACAGCTCAAAGTCTATCCTCTGCGAGTTGTAGAACTGACCCTCGGAGCCGCTCACTCGCCGGCAATAAACTCCCCCGGCAAAATAGCCCTGATCCACCCATTCCTGCATCTGTGTGCTGGAGAAGGGCCCGTACAGTTCCACTCCGTCTTTGTTCTCCCATTTGTACTCCCACATAACTTCATCCGATAACTGTGAATCTGCTGCCTTCTCCAGGGTTTGCTCTTCCACCTCATCAGCAAACATGTCCAGCTCAGCAGGTGGAGCCATGGTCTTGAGTCTGTATGCCAACTTCTCGTACGTGTCCTGATAGATCTCATACACTCCAAGGGCCACCATCTGATCTGCTAGAGATATGAGCAGCTCCAGGGGCTCTGGCCTATCTTCTGACTTGTTTGTTCCCTCCCTACTCTGTGCAGTTTCTGGTTTCCCATTATCTTGTGCTCTCTCCTTTAGGGACTCCTGACCCTGTTCACTTCCAACCCGGCTTTCCAGTTCCTTATTTTGTTCATCGTTGCTCTCTTGCCTTGAATCCGTTTCTCCCTCGTCCATTTTCGAATCTGCATTATATTCGTGCTCTCTGTCCTCCTTCTACCTAATCCCTCTATTCTTTCTTCTGAACGCTGGGTTCTGGCCGTCGTCCTGCTCTCTGCCCCCCAGTTAGTCCTTTTTGCCTCTTGCCCTCCCAAAAGGTTGGAATTCCTTTTGGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGTACAGCTCAAAGTC