ORFeome > cd302 ORF1 – XORFeome v1.0

cd302 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd302
Gene ID: 983081
Gene Page ID: 983079
ORF Xenbase ID: 17268477

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123208
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ838298
dbEST ID: 79656000
Trimmed Sequence: ATGAGGGCTCTAATACTGCTCTCCCTCTGCAGCGTTGCACATTGTACTGCTGGGCTCCCTGGATCAGACACCCAAGAAAATGGAAAAGGATGTCCATCTCCAGCCTGGGTTGGGTTTAACAGCAGCTGTTACACTTTCCTTCGCATTACACCAAAGAACTTGTTAAGTATTGAACCTGCTCAAGAACTTTGCAAAGCCTATGGTGCCAACCTTATAAGTATCATTACCGAAGAGGAAAACACATTTGTTTTAAAGTTGTTTCAAGCTCAATGGAAGGGCCCTGATAAAATCTTACTGGGCATGTTCTACGACAGTGATGACAACTCTATGAAATGGCTCGACCAGTCTGAAGTGAGGTTCACAAACTGGAGAGAAGAGAAGAATCCTAACAATCTAATCACTTGCACCACAATGAGCACAATCACAGGGCTGTGGGATCTCATCGACTGTGAAAATGTGGCTGAAATGGGAACTTTGTGTAAAAAAACAAATGCCCAAAATGAGAATACCTTACCAGATCTAAGGGCTTTAACAATCACCCTGATCATCTTTATAGTTCTTGTCGTTCTAAGTGTATCGGCAGTACTCTTGGGACTGTATAGGAGAAGCTCTACAGGATTTCTATCAAGGAACTATACCTTAGCCAGCGAGGTTCTTCCTTACTCAAATCAGCGTGTATTAGTGGACACAATTGGAAATGGAAGACTCTGCTTGCCTGGCCAACTTTCTTGTACAAAGTTGGCAATATAAAAAAACAATTCCTTAACCAATTTGTTTCCAACCAACCGAGGTCCCCAACCACTCCGAAATTAAAAATCCATTATTATAAAAAAAAC
Full Trace Sequence: GGGGCCCACATAATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGCTCTAATACTGCTCTCCCTCTGCAGCGTTGCACATTGTACTGCTGGGCTCCCTGGATCAGACACCCAAGAAAATGGAAAAGGATGTCCATCTCCAGCCTGGGTTGGGTTTAACAGCAGCTGTTACACTTTCCTTCGCATTACACCAAAGAACTTGTTAAGTATTGAACCTGCTCAAGAACTTTGCAAAGCCTATGGTGCCAACCTTATAAGTATCATTACCGAAGAGGAAAACACATTTGTTTTAAAGTTGTTTCAAGCTCAATGGAAGGGCCCTGATAAAATCTTACTGGGCATGTTCTACGACAGTGATGACAACTCTATGAAATGGCTCGACCAGTCTGAAGTGAGGTTCACAAACTGGAGAGAAGAGAAGAATCCTAACAATCTAATCACTTGCACCACAATGAGCACAATCACAGGGCTGTGGGATCTCATCGACTGTGAAAATGTGGCTGAAATGGGAACTTTGTGTAAAAAAACAAATGCCCAAAATGAGAATACCTTACCAGATCTAAGGGCTTTAACAATCACCCTGATCATCTTTATAGTTCTTGTCGTTCTAAGTGTATCGGCAGTACTCTTGGGACTGTATAGGAGAAGCTCTACAGGATTTCTATCAAGGAACTATACCTTAGCCAGCGAGGTTCTTCCTTACTCAAATCAGCGTGTATTAGTGGACACAATTGGAAATGGAAGACTCTGCTTGCCTGGCCAACTTTCTTGTACAAAGTTGGCAATATAAAAAAACAATTCCTTAACCAATTTGTTTCCAACCAACCGAGGTCCCCAACCACTCCGAAATTAAAAATCCATTATTATAAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGCTCTAATACTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838297
dbEST ID: 79655999
Trimmed Sequence: GGCAGCAGAGTCCTCCATTTCCACTGTGTCCACTAATACACGCTGATCTGAGTAAGGAAGAACCTCGCTGGCTAAGGTATAGTTCCTTGATAGAAATCCTGTAGAGCTTCTCCTATACAGTCCCAAGAGTACTGCCGATACACTTAGAACGACAAGAACTATAAAGATGATCAGGGTGATTGTTAAAGCCCTTAGATCTGGTAAGGTATTCTCATTTTGGGCATTTGTTTTTTTACACAAAGTTCCCATTTCAGCCACATTTTCACAGTCGATGAGATCCCACAGCCCTGTGATTGTGCTCATTGTGGTGCAAGTGATTAGATTGTTAGGATTCTTCTCTTCTCTCCAGTTTGTGAACCTCACTTCAGACTGGTCGAGCCATTTCATAGAGTTGTCATCACTGTCGTAGAACATGCCCAGTAAGATTTTATCAGGGCCCTTCCATTGAGCTTGAAACAACTTTAAAACAAATGTGTTTTCCTCTTCGGTAATGATACTTATAAGGTTGGCACCATAGGCCTTGCAAAGTTCTTGAGCAGGTTCAATACTTAACAAGTTCTTTGGTGTAATGCGAAGGAAAATGTAACAGCTGCTGTTAAACCCAACCCAGGCCGGAAAAAGGACATCCCTTTTCCATTTTCCTTGGGTGTCGGAACCGGGGAAGCCCAACAGTAAAAATGTGCAAACGCTGCGGAGGGAAGGACAGAAAATAAAAACCCCTTAAGGGTCCCAACTTTTTTTTGTAAAAAAAG
Full Trace Sequence: AGTCGACGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAGCAGAGTCCTCCATTTCCACTGTGTCCACTAATACACGCTGATCTGAGTAAGGAAGAACCTCGCTGGCTAAGGTATAGTTCCTTGATAGAAATCCTGTAGAGCTTCTCCTATACAGTCCCAAGAGTACTGCCGATACACTTAGAACGACAAGAACTATAAAGATGATCAGGGTGATTGTTAAAGCCCTTAGATCTGGTAAGGTATTCTCATTTTGGGCATTTGTTTTTTTACACAAAGTTCCCATTTCAGCCACATTTTCACAGTCGATGAGATCCCACAGCCCTGTGATTGTGCTCATTGTGGTGCAAGTGATTAGATTGTTAGGATTCTTCTCTTCTCTCCAGTTTGTGAACCTCACTTCAGACTGGTCGAGCCATTTCATAGAGTTGTCATCACTGTCGTAGAACATGCCCAGTAAGATTTTATCAGGGCCCTTCCATTGAGCTTGAAACAACTTTAAAACAAATGTGTTTTCCTCTTCGGTAATGATACTTATAAGGTTGGCACCATAGGCCTTGCAAAGTTCTTGAGCAGGTTCAATACTTAACAAGTTCTTTGGTGTAATGCGAAGGAAAATGTAACAGCTGCTGTTAAACCCAACCCAGGCCGGAAAAAGGACATCCCTTTTCCATTTTCCTTGGGTGTCGGAACCGGGGAAGCCCAACAGTAAAAATGTGCAAACGCTGCGGAGGGAAGGACAGAAAATAAAAACCCCTTAAGGGTCCCAACTTTTTTTTGTAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGCAGAGTCCTCCA