ORFeome > cd37 ORF1 – XORFeome v1.0

cd37 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd37
Gene ID: 5831830
Gene Page ID: 5831803
ORF Xenbase ID: 17268483

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC131890
Original XGC clone length: 675

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ838589
dbEST ID: 79656291
Trimmed Sequence: ATGATAGGCTCCTCGGTGCCCACCTTGAAGGTCTGGTCGTATGTATTCTCGGGCGTGGGAATCCTCACCATGCTGCTGGGTTTCCTAGGCTGCCTCGGGTCACTCAAGGAAATCAAATGCCTGCTGGGATTTTATTTTGCATTCCTTCTCCTGCTGTTTTCTGCACAGATCACCATTGGAGTGCTGGTGTACACACAGAGAAATAGTCTGAGTACAAGACTCGGCACAATTGTTGAATCTGTTATAAAAGACTATGGCTTGTATGGAAACCAGACAGATTTGGAGGAAGGCTGGGACTTTGCTCAAGAAAAGATGCAATGCTGTGGCTGGTATGCACCAGAAGACTGGCAGAAAAATCCGAAGATCCAGAACACATCAGCCAACCTGTATCCTTGTTCCTGCCAGAATGTTTCTGCTTTCCATACAAATAGCAGTACTAACTCATCCACGGAATATCCTGAGGCCGGATTCTGCACCACTGGTGCCACAAAGAAGTGGCCGGTATATCAAACAGGTTGCATGAACACACTGCAGGCATTCCTCCTAAATAACAGCATCACCATTGTCGGCGTGTGTATAGGTATTCCTCTGCTGGACCCTTTGTCTTGACGTTGTCCATGTGTTCGGTTAAAAAACCTGAACCAAAACTACAAAAAACCTGGCACCCTACTCTTTTCCCACTTTCTTGGTAAAATTTTGGAATTATAAAAAAGCAATTGCTTTATAATTTTGTGGCACCAAAAAGGGTCCTTAATCCATCAAAAAAAAAATCCATTATTTGCGCCTCTCCGCTCTAAATATCCACAAAAAAAAAAAA
Full Trace Sequence: GGCCCCCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATAGGCTCCTCGGTGCCCACCTTGAAGGTCTGGTCGTATGTATTCTCGGGCGTGGGAATCCTCACCATGCTGCTGGGTTTCCTAGGCTGCCTCGGGTCACTCAAGGAAATCAAATGCCTGCTGGGATTTTATTTTGCATTCCTTCTCCTGCTGTTTTCTGCACAGATCACCATTGGAGTGCTGGTGTACACACAGAGAAATAGTCTGAGTACAAGACTCGGCACAATTGTTGAATCTGTTATAAAAGACTATGGCTTGTATGGAAACCAGACAGATTTGGAGGAAGGCTGGGACTTTGCTCAAGAAAAGATGCAATGCTGTGGCTGGTATGCACCAGAAGACTGGCAGAAAAATCCGAAGATCCAGAACACATCAGCCAACCTGTATCCTTGTTCCTGCCAGAATGTTTCTGCTTTCCATACAAATAGCAGTACTAACTCATCCACGGAATATCCTGAGGCCGGATTCTGCACCACTGGTGCCACAAAGAAGTGGCCGGTATATCAAACAGGTTGCATGAACACACTGCAGGCATTCCTCCTAAATAACAGCATCACCATTGTCGGCGTGTGTATAGGTATTCCTCTGCTGGACCCTTTGTCTTGACGTTGTCCATGTGTTCGGTTAAAAAACCTGAACCAAAACTACAAAAAACCTGGCACCCTACTCTTTTCCCACTTTCTTGGTAAAATTTTGGAATTATAAAAAAGCAATTGCTTTATAATTTTGTGGCACCAAAAAGGGTCCTTAATCCATCAAAAAAAAAATCCATTATTTGCGCCTCTCCGCTCTAAATATCCACAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATAGGCTCCTCGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838588
dbEST ID: 79656290
Trimmed Sequence: AGAGTAGCGTGCCAGCTTGTTGTAGTTTTGGTCCAGGTTTCTACACAGACACATCGACAACGTCATGACAAAGAGCTCCAGCAGAGCGATACCTATACACACGCCGACAATGGTGATGCTGTTATTTAGGAGGAATGCCTGCAGTGTGTTCATGCAACCTGTTTGATATACCGGCCACTTCTTTGTGGCACCAGTGGTGCAGAATCCGGCCTCAGGATATTCCGTGGATGAGTTAGTACTGCTATTTGTATGGAAAGCAGAAACATTCTGGCAGGAACAAGGATACAGGTTGGCTGATGTGTTCTGGATCTTCGGATTTTTCTGCCAGTCTTCTGGTGCATACCAGCCACAGCATTGCATCTTTTCTTGAGCAAAGTCCCAGCCTTCCTCCAAATCTGTCTGGTTTCCATACAAGCCATAGTCTTTTATAACAGATTCAACAATTGTGCCGAGTCTTGTACTCAGACTATTTCTCTGTGTGTACACCAGCACTCCNATGGTGATCTGTGCAGAAGACAGCAGGAGAAAGAATGCAGAATAAAATCTCACCAGGCATTTGATTTCCTTGAATGACCCGAGGCGCCTAGGAAAACCACCGCATGGTGAGGATGCCCACGCCCAGAATACTACCAACCGAACTTCAAGGTGGGCACCGAGGAACCTATCAGGGGGCCACTTGTGTTTAACAAGTTTTGCATTAGGAGGGAAGGATGTGTCGAACAATTTTGGTGGGCAAAAAAAAAAAAAAACAAAAAAAAGGGAAA
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGTAGCGTGCCAGCTTGTTGTAGTTTTGGTCCAGGTTTCTACACAGACACATCGACAACGTCATGACAAAGAGCTCCAGCAGAGCGATACCTATACACACGCCGACAATGGTGATGCTGTTATTTAGGAGGAATGCCTGCAGTGTGTTCATGCAACCTGTTTGATATACCGGCCACTTCTTTGTGGCACCAGTGGTGCAGAATCCGGCCTCAGGATATTCCGTGGATGAGTTAGTACTGCTATTTGTATGGAAAGCAGAAACATTCTGGCAGGAACAAGGATACAGGTTGGCTGATGTGTTCTGGATCTTCGGATTTTTCTGCCAGTCTTCTGGTGCATACCAGCCACAGCATTGCATCTTTTCTTGAGCAAAGTCCCAGCCTTCCTCCAAATCTGTCTGGTTTCCATACAAGCCATAGTCTTTTATAACAGATTCAACAATTGTGCCGAGTCTTGTACTCAGACTATTTCTCTGTGTGTACACCAGCACTCCNATGGTGATCTGTGCAGAAGACAGCAGGAGAAAGAATGCAGAATAAAATCTCACCAGGCATTTGATTTCCTTGAATGACCCGAGGCGCCTAGGAAAACCACCGCATGGTGAGGATGCCCACGCCCAGAATACTACCAACCGAACTTCAAGGTGGGCACCGAGGAACCTATCAGGGGGCCACTTGTGTTTAACAAGTTTTGCATTAGGAGGGAAGGATGTGTCGAACAATTTTGGTGGGCAAAAAAAAAAAAAAACAAAAAAAAGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGTAGCGTGCCAGCTT