ORFeome > cd38 ORF1 – XORFeome v1.0

cd38 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd38
Gene ID: 945956
Gene Page ID: 945948
ORF Xenbase ID: 17268489

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129622
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID: 952
Ensembl gene IDs: ENSG00000004468
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,102700,108500,117000,124200,145600,170400,192605,208000,240600,248600,266120,278300,300322,300323,308240,600462,600996,601003,601382,601887,602475,604772,605258,608957,608971,609909

Library Location

Plate ID: GDExl11086
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ837808
dbEST ID: 79655510
Trimmed Sequence: ATGGCAACACATAGCAATTCTCGCTGCTCCCCAAGAGCCTGGGTGATAGGGATCATTGTTACTATTTGCGTTATTATTCCTATTATAAGCCTTATTGCTGCCTACACTGCCAATCAGAGGAAGGAGGACACTCATATATGGAAAGGGCAAGGGACGACTCAAAATCTGCAGGACATTGTTCTTGGGAGATGCTATAACTATGTAACAATGAATCCAGGCATAGGGAAAAAGAATTGTGACGCTATCTGGCAAGCACTGACAGGAGCTGTGTACAAGAAGAACCCCTGCAACATCACACAGGAGGATTACAAACCCTTAGCAGATTTGGCTTTACAAACAATTCCATGTAATAAGACGCTCCTGTGGAGTAAAACGAATTCCCTGGTGCACCGCTACACAAAGGCATCACAAGACTTATTGACGCTTGAGGACACATTTCTGGGCTCCATGTTTGACAGCTTGATGTGGTGCGGGATGTCCTACAGCTCAGAAATGAACTATGACTCCTGCCCAGCTTGGAATGAATGTGACAATAACGCTATATCTGCTTTTTGGAAGATGGCATCTGCTACATTTGCCAAAGCATCGTGTGGCGTGGTCAATGTAATGCTCAATGGATCGGCAGATGGTGGATTTGCCAGGGAAGGAAAGCATCCTTCGAACAGTTGAATTACCAAGCATGGATGTAAATGCATTATTCAAAATTCCAATAATGAATCTAAAATTAACCTGGAAGGGGGCCAAAAAAGAAACTCCGGTGAAACGGAAATCCCCGGGTGGAAAATGTAAAAATTAAATTTTTGAACAACACCCAAAATTGC
Full Trace Sequence: GCGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACACATAGCAATTCTCGCTGCTCCCCAAGAGCCTGGGTGATAGGGATCATTGTTACTATTTGCGTTATTATTCCTATTATAAGCCTTATTGCTGCCTACACTGCCAATCAGAGGAAGGAGGACACTCATATATGGAAAGGGCAAGGGACGACTCAAAATCTGCAGGACATTGTTCTTGGGAGATGCTATAACTATGTAACAATGAATCCAGGCATAGGGAAAAAGAATTGTGACGCTATCTGGCAAGCACTGACAGGAGCTGTGTACAAGAAGAACCCCTGCAACATCACACAGGAGGATTACAAACCCTTAGCAGATTTGGCTTTACAAACAATTCCATGTAATAAGACGCTCCTGTGGAGTAAAACGAATTCCCTGGTGCACCGCTACACAAAGGCATCACAAGACTTATTGACGCTTGAGGACACATTTCTGGGCTCCATGTTTGACAGCTTGATGTGGTGCGGGATGTCCTACAGCTCAGAAATGAACTATGACTCCTGCCCAGCTTGGAATGAATGTGACAATAACGCTATATCTGCTTTTTGGAAGATGGCATCTGCTACATTTGCCAAAGCATCGTGTGGCGTGGTCAATGTAATGCTCAATGGATCGGCAGATGGTGGATTTGCCAGGGAAGGAAAGCATCCTTCGAACAGTTGAATTACCAAGCATGGATGTAAATGCATTATTCAAAATTCCAATAATGAATCTAAAATTAACCTGGAAGGGGGCCAAAAAAGAAACTCCGGTGAAACGGAAATCCCCGGGTGGAAAATGTAAAAATTAAATTTTTGAACAACACCCAAAATTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACACATAGCAATTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837807
dbEST ID: 79655509
Trimmed Sequence: TGATTTGCACAGTTTGCATGCGGGGAGATCTGGAGTTTCTATGCACTGCAGCAGCTGCACCGGCCTATAGTTGTCTATGCAGGAGAAAGGCAGTTTGTGCTGCTCAATATAATCTTTCAGTTCCACCGCGGATTCCGTATCACAGGAGTTCTTGTCTGGCCCCTCCAGGTCATCTATGATCCATAATCGGACTTCTGATACTGCATTTACATTCATGCTTGGTACTTCAACTGTTCGAAGGATGCTTTCCTTCCTGGCAACTCCACCATCTGCCGATCCATTGAGCATTACATTGACCACGCCACACGATGCTTTGGCAAATGTAGCAGATGCCATCTTCCAAAAAGCAGATATAGCGTTATTGTCACATTCATTCCAAGCTGGGCAGGAGTCATAGTTCATTTCTGAGCTGTAGGACATCCCGCACCACATCAAGCTGTCAAACATGGAGCCCAGAAATGTGTCCTCAAGCGTCAATAAGTCTTGTGATGCCTTTGTGTAGCGGTGCACCAGGGAATTCGTTTTACTCCACAGGAGCGTCTTATTACAGGGAATTGTTTGTAAAGCCAAATCTGCTAAGGGTTTGTAATCCTCCTGTGTGATGTTGCAGGGGTTCGTCTTGTACACGGCTCCTGTCAGTGGCTGCCAGATAACGTCACAATTCTTTTTCCCTATGCCTGGATTCATTGTTACTAGTTATAGCATCTCCCAAGAACAATGTCCTGGAGATTTTGAGTCGTCCCTTGCCCTTTCCAAATTTAATTTCCTCCTTTCCCTAAATGCAGTGTAGGCAGAATAAGGCTTATAATAGGAAAAATAACCCAATAGTAGCAAGGTCCGCGGCACCCAGGCTTTTGGGGAGGAGGGAGAGTGGCATGGTGTTGCATGTGGGCGCCTTGTTGTAACAAATTGGCTTAATAAAAAAGATTGCTCATCAATTTTTTTCCCCGAACAGGTCACTTTTGGTCAAAAAAAAAAAAAAAATAAAGAAAAATCACACAAGACTGTGCGTCGTTTCAAAAACACTCGAACATGAGGGAANCNGAGGGAGAGGGGGGGGAGGNAGANGAANTATCGGATTGTTTTATGGGACGAGTAGAGGGGTCAAAAGGGGNANGAACNGCGGCGGAGGAGGGGAATAGAGAGNNGAGTNTGAAGAGAANNTGGNAAGAAGAAAGGTGGAAGNGCGGNGTAGAG
Full Trace Sequence: GGGCAGGGCAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATTTGCACAGTTTGCATGCGGGGAGATCTGGAGTTTCTATGCACTGCAGCAGCTGCACCGGCCTATAGTTGTCTATGCAGGAGAAAGGCAGTTTGTGCTGCTCAATATAATCTTTCAGTTCCACCGCGGATTCCGTATCACAGGAGTTCTTGTCTGGCCCCTCCAGGTCATCTATGATCCATAATCGGACTTCTGATACTGCATTTACATTCATGCTTGGTACTTCAACTGTTCGAAGGATGCTTTCCTTCCTGGCAACTCCACCATCTGCCGATCCATTGAGCATTACATTGACCACGCCACACGATGCTTTGGCAAATGTAGCAGATGCCATCTTCCAAAAAGCAGATATAGCGTTATTGTCACATTCATTCCAAGCTGGGCAGGAGTCATAGTTCATTTCTGAGCTGTAGGACATCCCGCACCACATCAAGCTGTCAAACATGGAGCCCAGAAATGTGTCCTCAAGCGTCAATAAGTCTTGTGATGCCTTTGTGTAGCGGTGCACCAGGGAATTCGTTTTACTCCACAGGAGCGTCTTATTACAGGGAATTGTTTGTAAAGCCAAATCTGCTAAGGGTTTGTAATCCTCCTGTGTGATGTTGCAGGGGTTCGTCTTGTACACGGCTCCTGTCAGTGGCTGCCAGATAACGTCACAATTCTTTTTCCCTATGCCTGGATTCATTGTTACTAGTTATAGCATCTCCCAAGAACAATGTCCTGGAGATTTTGAGTCGTCCCTTGCCCTTTCCAAATTTAATTTCCTCCTTTCCCTAAATGCAGTGTAGGCAGAATAAGGCTTATAATAGGAAAAATAACCCAATAGTAGCAAGGTCCGCGGCACCCAGGCTTTTGGGGAGGAGGGAGAGTGGCATGGTGTTGCATGTGGGCGCCTTGTTGTAACAAATTGGCTTAATAAAAAAGATTGCTCATCAATTTTTTTCCCCGAACAGGTCACTTTTGGTCAAAAAAAAAAAAAAAATAAAGAAAAATCACACAAGACTGTGCGTCGTTTCAAAAACACTCGAACATGAGGGAANCNGAGGGAGAGGGGGGGGAGGNAGANGAANTATCGGATTGTTTTATGGGACGAGTAGAGGGGTCAAAAGGGGNANGAACNGCGGCGGAGGAGGGGAATAGAGAGNNGAGTNTGAAGAGAANNTGGNAAGAAGAAAGGTGGAAGNGCGGNGTAGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATTTGCACAGTTTGCATGCGG