ORFeome > cd44 ORF1 – XORFeome v1.0

cd44 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cd44
Gene ID: 6251905
Gene Page ID: 487546
ORF Xenbase ID: 17268495

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC111505
Original XGC clone length: 837

Human orthology & disease relationships

NCBI Entrez ID: 960
Ensembl gene IDs: ENSG00000026508
Directly associated (OMIM) disease MIM numbers: 609027
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ837667
dbEST ID: 79655369
Trimmed Sequence: ATGGCCTCACTGCTGTGGATTGTTACTGGGCTCTGCTGCCTGCTGAGTGTTTGCCAAGCGCGTACAGTTATCAGCTGCCGCTTCAAAGGGGTTTTCCATGTGGAAAAGAACGATCGATATTCACTGAATCAGGAAGATGCCGTAAAGCTCTGCGGGATGCTCAACACCACCATTGCAAGTTATGCGCAATTGAAGATCGCCTTGGATGTTGGCTTTGAAACCTGCAGATACGGCTGGATTGAAGACCGTGTAGTGATACCACGAATCAAACCAAATCCCATATGTGCTGCCAATTACACCGGCATCTACACCCTTGGCAATAACGAGTCCCTGCGCTACGACGTCTACTGCTACAATGCCTCAGAGACGGAAGACAAGTCCTGCTTACCTGTTCTCCTCCTCAACGAAACAGATTTTTCTCACAACACCATCGACTCGTATGATCCGACCTTAGATGGAGAAGATGACAAGAAGGGAAGAATGTTGAACACAGATCCGTCATCTGAGAATGCTGAGCTCAACAATGAACCCAAACAGAAAAAAGGGGCTAGAGTTCCTGACTGGTTAAATGTGGTGGTGGCTCTCGTGGCTCTGGGGCTTATATTGACTGTCTGTCTTGCAATCAATTCCCCCACACTGTGCGGCCCCGAGAAAAAAATTGTTAATAATTGGAAACAAAACAAAAACTGGAAAACGGGGAAGATCATGGAAACAAAGTGGAAAAAAATGTTCAAGTCTCCAGAAATTGCTCAAA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTCACTGCTGTGGATTGTTACTGGGCTCTGCTGCCTGCTGAGTGTTTGCCAAGCGCGTACAGTTATCAGCTGCCGCTTCAAAGGGGTTTTCCATGTGGAAAAGAACGATCGATATTCACTGAATCAGGAAGATGCCGTAAAGCTCTGCGGGATGCTCAACACCACCATTGCAAGTTATGCGCAATTGAAGATCGCCTTGGATGTTGGCTTTGAAACCTGCAGATACGGCTGGATTGAAGACCGTGTAGTGATACCACGAATCAAACCAAATCCCATATGTGCTGCCAATTACACCGGCATCTACACCCTTGGCAATAACGAGTCCCTGCGCTACGACGTCTACTGCTACAATGCCTCAGAGACGGAAGACAAGTCCTGCTTACCTGTTCTCCTCCTCAACGAAACAGATTTTTCTCACAACACCATCGACTCGTATGATCCGACCTTAGATGGAGAAGATGACAAGAAGGGAAGAATGTTGAACACAGATCCGTCATCTGAGAATGCTGAGCTCAACAATGAACCCAAACAGAAAAAAGGGGCTAGAGTTCCTGACTGGTTAAATGTGGTGGTGGCTCTCGTGGCTCTGGGGCTTATATTGACTGTCTGTCTTGCAATCAATTCCCCCACACTGTGCGGCCCCGAGAAAAAAATTGTTAATAATTGGAAACAAAACAAAAACTGGAAAACGGGGAAGATCATGGAAACAAAGTGGAAAAAAATGTTCAAGTCTCCAGAAATTGCTCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTCACTGCTGTGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ837666
dbEST ID: 79655368
Trimmed Sequence: GACTACGATTTTCATGTCTACATCCTTCTTATTCTGAATGATATCTTCTTGGGGGTCTTGGTCGACTGTGTGCTCTTGGGACACCAGTTGTACCATCTCTTGAGACTTGACATTGTCTCCATTTTGCTCCATGATCTCCCCGTCTTCCAGTTTTGCTTTGTTTCCATTTATTACCAGTTTCTTCTTTTGGCCACACAGTCTGCGGGAGTTGATTGCAAGACAGACAAACAATATCAGCCCCAGAGCCACGAGAGCCACCACCACAATTAACCACTCAGGAACTCTAGCCCCTCTTTTCTGTTTGGGTTCATTGTGGAGCTCAGCATTCTCAGATGAGGGAGGTGTGTTCAACATTCTTCCCTTCTTGTCATCTTCTCCATCTAAAGGGGGATCATACGAATCGAGTGGGGTGTGAGAGAATCTGTTTGGTTAAGGAGGAAGAAAGGTGGCAGGACGTGTCGTCCGTCGCTGAGGGAGGGTAGGAAAGAAATCGGGGCAGGACGAGGGGGTATTGAGCGGAGGGGGGAGACCGCTGGAGGTGGTGGGGAGAGGGGGGTGGGTTGGGGGGGGGGTAGGGAAGAAAGGCGTGGGCCCGCCCGCGGGGGGGGGTGGGGGGGGGGGGAGGCGGGGGGGGGAGAGGTCAGGGAGGGGAGGGGGGGGGGGGGAGGAGGGAAAGAGAAGGGGGGCGCGTGGCGCGTAAGGAGGGAGGGGCGGGTCGGACGGGGGAGGGCGTAGTAGGGGGAGGGGGGTGGTGGGCGGGAGGGGGGGAGGGGGGGGGAGGGAGGGGGGAGAGAGAGAGGAAAGGAGGGGGGAGGGGGGGGGTGGAATGGGGGGGGGGAAAGGGGAGGAGTAGGGGGGGTGGGGGGGGGGGGGGGAAAAAAAAAAAAAAGAAAAAAAAGAAACATGAACAAACAAAAAAAGAAGAGAGAGAAAAGGGAAGGAGGGCGAGCGGGGGGGGGGGGGAGGAACGGGAAGGGGGGGAGAGAGAAAGGGCAGAGGAAAAGGGGCGGGGGGGGGGGGGGGGGGGGGGAGGGGAGNGGAGAGGGGGGAGGGAGANAAAAGGGGAAGAAGGAGGGANGGGGGGGAGGAGGGGGGGNGGGAAAGGANGANGGAGGGGGGANGGGGTGNNAGNCGNAGNNGCGGNCGGGANGG
Full Trace Sequence: CGGCAAGGGAACAGCTTATGACCATGGTAATACGACTCCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTACGATTTTCATGTCTACATCCTTCTTATTCTGAATGATATCTTCTTGGGGGTCTTGGTCGACTGTGTGCTCTTGGGACACCAGTTGTACCATCTCTTGAGACTTGACATTGTCTCCATTTTGCTCCATGATCTCCCCGTCTTCCAGTTTTGCTTTGTTTCCATTTATTACCAGTTTCTTCTTTTGGCCACACAGTCTGCGGGAGTTGATTGCAAGACAGACAAACAATATCAGCCCCAGAGCCACGAGAGCCACCACCACAATTAACCACTCAGGAACTCTAGCCCCTCTTTTCTGTTTGGGTTCATTGTGGAGCTCAGCATTCTCAGATGAGGGAGGTGTGTTCAACATTCTTCCCTTCTTGTCATCTTCTCCATCTAAAGGGGGATCATACGAATCGAGTGGGGTGTGAGAGAATCTGTTTGGTTAAGGAGGAAGAAAGGTGGCAGGACGTGTCGTCCGTCGCTGAGGGAGGGTAGGAAAGAAATCGGGGCAGGACGAGGGGGTATTGAGCGGAGGGGGGAGACCGCTGGAGGTGGTGGGGAGAGGGGGGTGGGTTGGGGGGGGGGTAGGGAAGAAAGGCGTGGGCCCGCCCGCGGGGGGGGGTGGGGGGGGGGGGAGGCGGGGGGGGGAGAGGTCAGGGAGGGGAGGGGGGGGGGGGGAGGAGGGAAAGAGAAGGGGGGCGCGTGGCGCGTAAGGAGGGAGGGGCGGGTCGGACGGGGGAGGGCGTAGTAGGGGGAGGGGGGTGGTGGGCGGGAGGGGGGGAGGGGGGGGGAGGGAGGGGGGAGAGAGAGAGGAAAGGAGGGGGGAGGGGGGGGGTGGAATGGGGGGGGGGAAAGGGGAGGAGTAGGGGGGGTGGGGGGGGGGGGGGGAAAAAAAAAAAAAAGAAAAAAAAGAAACATGAACAAACAAAAAAAGAAGAGAGAGAAAAGGGAAGGAGGGCGAGCGGGGGGGGGGGGGAGGAACGGGAAGGGGGGGAGAGAGAAAGGGCAGAGGAAAAGGGGCGGGGGGGGGGGGGGGGGGGGGGAGGGGAGNGGAGAGGGGGGAGGGAGANAAAAGGGGAAGAAGGAGGGANGGGGGGGAGGAGGGGGGGNGGGAAAGGANGANGGAGGGGGGANGGGGTGNNAGNCGNAGNNGCGGNCGGGANGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTACGATTTTCATGTCTACATC