ORFeome > cd63 ORF1 – XORFeome v1.0

cd63 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cd63
Gene ID: 1015236
Gene Page ID: 1015226
ORF Xenbase ID: 17268507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054957
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ839086
dbEST ID: 79656788
Trimmed Sequence: ATGGCGGTGGAAGGGGGAATGAAATGTGTCAAGTTCCTTATGTTCTTCTTCAACTTCGTGTTCTGGGTGTGCGGTATTGCTCTGATAGCAATTGGGATCTATGTGCAAATCCAGCTTAACCACACTCTCATCATGAAAAATGCCGCATCCTCTGGAGCTCCTATAGTCGTCATTGTAGTGGGTGTTGTCATATTCTTAATTGCGTTCTTTGGATGCTGTGGAGCACTAAAGGAGAACTACTGCATGGTGACAACGTTTGCTGTTGTGCTGGTGCTGATCTTCCTGGTTGAGATTGCTGCTGCTATTGCTGCCTATGTTTACAAGGATAAGCTGCGCACTGCATTTGAAGACTCCTTTAAAAATGGCATGTCCAAATACAATACCACCAAGGACATAACTGAGAGCATTGACCTCTTGCAGAAAGAATTTAAGTGCTGTGGTGCCTTCAACGCAACTGATTGGAAGCAATATCCTCCCTTCAACGGTACAGATGCGGTGCCGGATTCCTGCTGTAAAACCATCATTGCAGGCTGTGGAAAGGATCCTAGTGCAACTATAAATACTGATGGCTGTGCAACCGGAATAGACCAATGGGTAAAGAAAAACATAGGAATTGTGGCTGGAATGGCCCTGGGAATTGCTTTGTTTGAAAATTGGGGATCATCTTTGCCTGCTGTTTATGAAAGGAATAAAAAATGGATATTAATTCATGGTTGCCAACTTTCTTGTACAAGTTTGGCATTAAAAAAAAACTTTGCTTAACCAATTTGTT
Full Trace Sequence: GCTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGGAAGGGGGAATGAAATGTGTCAAGTTCCTTATGTTCTTCTTCAACTTCGTGTTCTGGGTGTGCGGTATTGCTCTGATAGCAATTGGGATCTATGTGCAAATCCAGCTTAACCACACTCTCATCATGAAAAATGCCGCATCCTCTGGAGCTCCTATAGTCGTCATTGTAGTGGGTGTTGTCATATTCTTAATTGCGTTCTTTGGATGCTGTGGAGCACTAAAGGAGAACTACTGCATGGTGACAACGTTTGCTGTTGTGCTGGTGCTGATCTTCCTGGTTGAGATTGCTGCTGCTATTGCTGCCTATGTTTACAAGGATAAGCTGCGCACTGCATTTGAAGACTCCTTTAAAAATGGCATGTCCAAATACAATACCACCAAGGACATAACTGAGAGCATTGACCTCTTGCAGAAAGAATTTAAGTGCTGTGGTGCCTTCAACGCAACTGATTGGAAGCAATATCCTCCCTTCAACGGTACAGATGCGGTGCCGGATTCCTGCTGTAAAACCATCATTGCAGGCTGTGGAAAGGATCCTAGTGCAACTATAAATACTGATGGCTGTGCAACCGGAATAGACCAATGGGTAAAGAAAAACATAGGAATTGTGGCTGGAATGGCCCTGGGAATTGCTTTGTTTGAAAATTGGGGATCATCTTTGCCTGCTGTTTATGAAAGGAATAAAAAATGGATATTAATTCATGGTTGCCAACTTTCTTGTACAAGTTTGGCATTAAAAAAAAACTTTGCTTAACCAATTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGGAAGGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839085
dbEST ID: 79656787
Trimmed Sequence: CATGACTTCATATCCACTTCTTATTCCCTTCATTAAACAGCAGGCAAAGATGATCCCCAATATCTCAAACAAAGCAATTCCCAGGGCCACTCCAGCCACAATTCCTATGTTTTTCTTTACCCATTGGTCTATTCCGGTTGCACAGCCATCAGTATTTATAGTTGCACTAGGATCCTTTCCACAGCCTGCAATGATGGTTTTACAGCAGGAATCCGGCACCGCATCTGTACCGTTGAAGGGAGGATATTGCTTCCAATCAGTTGCGTTGAAGGCACCACAGCACTTAAATTCTTTCTGCAAGAGGTCAATGCTCTCAGTTATGTCCTTGGTGGTATTGTATTTGGACATGCCATTTTTAAAGGAGTCTTCAAATGCAGTGCGCAGCTTATCCTTGTAAACATAGGCAGCAATAGCAGCAGCAATCTCAACCAGGAAGATCAGCACCAGCACAACAGCAAACGTTGTCACCATGCAGTAGTTCTCCTTTAGTGCTCCACAGCATCCAAAGAACGCAATTAAGAATATGACAACACCCACTACAATGACGACTATAGGAGCTCCAGAGGATGCGGCATTTTTCATGATGAGAGTGTGGTTAACCTGGAATTGAACATAGATCCCAATTGCTATAAAACCAATACCGCAAACCCAAAAAACGAAATTGAAAAAAAAACATAAAGGAACTTGAAACCTTTTCATTTCCCCCTTCTCCCCCCCCTGGGGGGCCCAACTTTTTTTGTAAACAAAGTTTGGGAAAATAAAAAAAAAAGCATTTTGG
Full Trace Sequence: CGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGACTTCATATCCACTTCTTATTCCCTTCATTAAACAGCAGGCAAAGATGATCCCCAATATCTCAAACAAAGCAATTCCCAGGGCCACTCCAGCCACAATTCCTATGTTTTTCTTTACCCATTGGTCTATTCCGGTTGCACAGCCATCAGTATTTATAGTTGCACTAGGATCCTTTCCACAGCCTGCAATGATGGTTTTACAGCAGGAATCCGGCACCGCATCTGTACCGTTGAAGGGAGGATATTGCTTCCAATCAGTTGCGTTGAAGGCACCACAGCACTTAAATTCTTTCTGCAAGAGGTCAATGCTCTCAGTTATGTCCTTGGTGGTATTGTATTTGGACATGCCATTTTTAAAGGAGTCTTCAAATGCAGTGCGCAGCTTATCCTTGTAAACATAGGCAGCAATAGCAGCAGCAATCTCAACCAGGAAGATCAGCACCAGCACAACAGCAAACGTTGTCACCATGCAGTAGTTCTCCTTTAGTGCTCCACAGCATCCAAAGAACGCAATTAAGAATATGACAACACCCACTACAATGACGACTATAGGAGCTCCAGAGGATGCGGCATTTTTCATGATGAGAGTGTGGTTAACCTGGAATTGAACATAGATCCCAATTGCTATAAAACCAATACCGCAAACCCAAAAAACGAAATTGAAAAAAAAACATAAAGGAACTTGAAACCTTTTCATTTCCCCCTTCTCCCCCCCCTGGGGGGCCCAACTTTTTTTGTAAACAAAGTTTGGGAAAATAAAAAAAAAAGCATTTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGACTTCATATCCACTTCTTAT