ORFeome > cdc23-prov ORF1 – XORFeome v1.0

cdc23-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256595
Gene Page ID:
ORF Xenbase ID: 17268585

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042346
Original XGC clone length: 1569

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ823664
dbEST ID: 79641366
Trimmed Sequence: ATGGAGGATGCCCAGGACCTGGATGCATATACACTGGCTAAGTCTTACTTTGACCTAAAAGAATATGATCGAGCTGCATATTTTCTTCGGGGGTGTAAAAGTCAAAAAGCCTATTTCTTGTACATGTACTCCAGGTATTTGTCTGGAGAAAAGAAGAAGGACGATGAAACAGTTGATAGCCTTGGTCCCCTTGAAAAGGGGCAGGTAAAGAATGAAGCACTGCGGGAACTACGTGTGGAGCTGAGTAAGAAGCATAAAGCCAGGGAATTAGATGGATTTGGACTTTACTTGTATGGAGTGGTCTTGAGGAAGCTGGATCTGGCAAAAGAAGCTTTAGATGTATTTGTGGAGGCAACACATGTCTTGCCTTTGCATTGGGGAACCTGGCTGGAATTATGCAATTTGATTACCGACAAAGAGATGCTAAAGTTCCTGTCCCTGCCAGACTCATGGATAAAGGAATTCTTCTTGGCACACATATACACAGAGTTACAGTTAATCGAGGAGGCATTGCAGAAATACCAAAGTCTTATTGATGCTGGCTTCTCTAAGAGTACTTACATTATTTCTCAAATTGCTGTTGCCTATCATAACATCCGAGATATTGACAAAGCTCTGTCTATATTCAATGAGCTGCGGAAACAGGATCCCTACAGAATAGAAAATATGGACACCTTTTCCAACCTGCTGTATGTCAGGGGTCTTAAACCAGAACTAAGCTATCTGGCTCACAATCTCTGTGACATTGACAAGTACCGAAGTTAAAACGTGGTGGTGTAATTGGCAATTNATTAACAGGCCTTCGCCTCCCAACATGAAAAAA
Full Trace Sequence: TAGTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGATGCCCAGGACCTGGATGCATATACACTGGCTAAGTCTTACTTTGACCTAAAAGAATATGATCGAGCTGCATATTTTCTTCGGGGGTGTAAAAGTCAAAAAGCCTATTTCTTGTACATGTACTCCAGGTATTTGTCTGGAGAAAAGAAGAAGGACGATGAAACAGTTGATAGCCTTGGTCCCCTTGAAAAGGGGCAGGTAAAGAATGAAGCACTGCGGGAACTACGTGTGGAGCTGAGTAAGAAGCATAAAGCCAGGGAATTAGATGGATTTGGACTTTACTTGTATGGAGTGGTCTTGAGGAAGCTGGATCTGGCAAAAGAAGCTTTAGATGTATTTGTGGAGGCAACACATGTCTTGCCTTTGCATTGGGGAACCTGGCTGGAATTATGCAATTTGATTACCGACAAAGAGATGCTAAAGTTCCTGTCCCTGCCAGACTCATGGATAAAGGAATTCTTCTTGGCACACATATACACAGAGTTACAGTTAATCGAGGAGGCATTGCAGAAATACCAAAGTCTTATTGATGCTGGCTTCTCTAAGAGTACTTACATTATTTCTCAAATTGCTGTTGCCTATCATAACATCCGAGATATTGACAAAGCTCTGTCTATATTCAATGAGCTGCGGAAACAGGATCCCTACAGAATAGAAAATATGGACACCTTTTCCAACCTGCTGTATGTCAGGGGTCTTAAACCAGAACTAAGCTATCTGGCTCACAATCTCTGTGACATTGACAAGTACCGAAGTTAAAACGTGGTGGTGTAATTGGCAATTNATTAACAGGCCTTCGCCTCCCAACATGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGATGCCCAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828973
dbEST ID: 79646675
Trimmed Sequence: TGGTGTGACCGATGAAAGGTTAAGTGGAGACACTCGTCTTGTAGGGGTGTTGTTGGCGGAAAGTGATTGTGGAAGGAAGAAAGCAGCAGTGGCTGGGAGATCAGCTGATGGACTTTCATTCTGGTTCCTACACTGTAGAATCTGACGTAGAAGAGCTTTGCCTTCTTCCCTGGTATCATTAAAATTGAAACATTTCTGGGCACATGCAGATGCCTCATCCCACAGCTTGCACTTAAAGTAATACTGAGCCAGATAGCGAAAGGCTGTGCTGACCTCCTGGTGCTCCACAATTTCCCCACAGGAGTAGATGTCCTGTATGTATTTGATGTAACACTGGGCAGCCTGTTCCGATTCGTTCAGTTGTTCATGAAGCTTTGCCAGCTTGACCAGAGCCATTTTCTCCACATCACCCACAGCATAAGCTCTCCAGTAACATTTTTTAGCCTCCACAAGTTGATTAAGCTTTTCATAACATTCCCCCAAAGCAACAAGCATTCTAGAGTCGTTGGGTCTGAGCTGATGGGCCCGTCTATAATAATAAAGGCAGTAAAACGGCATCTTTAAAATTTCATAGGTTTGTCCTAATCCATACCAAGCACGATAATCTCTCTTGTTCACTTNCATTGCATGNCCTGTAGCCTGTATTGCTGCAGAGGTATTCTTCAATTCCATGTAATTCATGTCCCATGAAGGGTCCACGCACCAAGAAATTTCCAAGGGTTGGAATTTTAAGGGCCTTTTTGGAAAGTCAAAGGGCTGGCTTTTTTCTCGGGTTG
Full Trace Sequence: TGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTGTGACCGATGAAAGGTTAAGTGGAGACACTCGTCTTGTAGGGGTGTTGTTGGCGGAAAGTGATTGTGGAAGGAAGAAAGCAGCAGTGGCTGGGAGATCAGCTGATGGACTTTCATTCTGGTTCCTACACTGTAGAATCTGACGTAGAAGAGCTTTGCCTTCTTCCCTGGTATCATTAAAATTGAAACATTTCTGGGCACATGCAGATGCCTCATCCCACAGCTTGCACTTAAAGTAATACTGAGCCAGATAGCGAAAGGCTGTGCTGACCTCCTGGTGCTCCACAATTTCCCCACAGGAGTAGATGTCCTGTATGTATTTGATGTAACACTGGGCAGCCTGTTCCGATTCGTTCAGTTGTTCATGAAGCTTTGCCAGCTTGACCAGAGCCATTTTCTCCACATCACCCACAGCATAAGCTCTCCAGTAACATTTTTTAGCCTCCACAAGTTGATTAAGCTTTTCATAACATTCCCCCAAAGCAACAAGCATTCTAGAGTCGTTGGGTCTGAGCTGATGGGCCCGTCTATAATAATAAAGGCAGTAAAACGGCATCTTTAAAATTTCATAGGTTTGTCCTAATCCATACCAAGCACGATAATCTCTCTTGTTCACTTNCATTGCATGNCCTGTAGCCTGTATTGCTGCAGAGGTATTCTTCAATTCCATGTAATTCATGTCCCATGAAGGGTCCACGCACCAAGAAATTTCCAAGGGTTGGAATTTTAAGGGCCTTTTTGGAAAGTCAAAGGGCTGGCTTTTTTCTCGGGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTGTGACCGATGAAAG